Functional Analysis of Synthetic Promoters Containing Pathogen-Responsive  cis -Elements

S.B. Yeri; R.S. Bhat; M.S. Kuruvinashetti

Functional Analysis of Synthetic Promoters Containing Pathogen-Responsive cis-Elements

S.B. Yeri

, R.S. Bhat

, M.S. Kuruvinashetti

Department of Biotechnology, University of Agricultural Sciences, Dharwad 580005, India

Author

Correspondence author
Molecular Plant Breeding, 2013, Vol. 4, No. 34 doi: 10.5376/mpb.2013.04.0034
Received: 25 Sep., 2013 Accepted: 15 Oct., 2013 Published: 17 Oct., 2013

This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Preferred citation for this article:

Yeri et al., Functional Analysis of Synthetic Promoters Containing Pathogen-Responsive Cis-Elements, Molecular Plant Breeding, Vol.4, No. 34 270-276 (doi: 10.5376/mpb.2013.04.0034)

Abstract

An attempt was made to study four synthetic promoters containing pathogen-responsive cis-elements with -46 region minimal promoter of CaMV 35S for their inducibility in tobacco upon exposure to salicylic acid (SA) and methyl jasmonate (MeJ). On 15^th day of establishment, none of the untreated plants, except those carrying CaMV 35S-driven SgfpS65T showed reporter expression. Plants sprayed with 5 mM SA or MeJ showed SgfpS65T expression after 5 min, 1 hr, 2 hr, 3hr and 7 hr. GCC2X and S2X were induced by both SA and MeJ, W2X was induced by SA, but not by MeJ. However, GCC3X promoter did not show any induction. With SA, the strength of induction of W2X and GCC2X promoters as measured by ImageJ software were comparable and relatively higher than S2X. Similarly, GCC2X and S2X had similar magnitude of induction with MeJ. In general, the synthetic promoters were more strongly induced by SA compared to MeJ, however their strength was less compared to that of CaMV 35S promoter.

Keywords

S.B. Yeri; R.S. Bhat; M.S. Kuruvinashetti

Precise control of transgene expression is important when the aim is to develop disease resistant transgenics. Genes driven with cauliflower mosaic virus (CaMV) 35S promoter have led to several morphological ill effects (Fischer et al., 1997). Use of pathogen-inducible promoters could minimize such effects (Coutos-Thevenot et al., 2001)^.Perception of pathogen by a plant triggers rapid defense responses via a number of signal transduction pathways (Anderson et al., 2005; Scheideler et al., 2002). Trans- criptional activation in many of the pathways is brought about by binding of transcription factors to the cis-acting elements present in the upstream promoter regions of pathogen responsive genes. These cis-acting regulatory elements or boxes include W, D, GCC, S and Myb sequences (Rushton et al., 2002; Rushton et al., 1996).

These cis-acting elements retain pathogen-inducible expression even when isolated and fused to a minimal promoter. The realization that pathogen-inducible promoters contain cis-acting elements (Gurr and Rushton, 2005) and that they are largely conserved across species (Eulgem et al., 1999), has led to attempts on precise promoter tuning by selectively including such elements that contribute significantly to promoter strength and activity. Randomizing these elements from various sources could be done by synthetic promoters (Rushton et al., 2002), and there activity characterized by analyzing the products of its downstream gene. The most common approach to study activity of a plant promoter, however, is to employ a promoter-probe vector wherein the promoter to be tested is fused to a reporter gene. Expression of the reporter not only permits qualitative and/or quantitative analysis of promoters, but also its expression pattern in response to environmental cues.

Previous effort indicated that synthetic promoters with multiple copies (4 or 8) of pathogen-responsive cis-acting elements led to reporter gene expression even in the absence of a pathogen-derived peptide elicitor, pep25 (Rushton et al., 2002). Considering the importance of pathogen-inducible promoters in transgene expression, an effort was made to analyze expression pattern of synthetic promoters containing two or three copies of W, GCC and S boxes in transgenic tobacco plants treated with methyl jasmonate (MeJ) and salicylic acid (SA).

Materials and Methods

Synthetic promoters used for expression analysis

W2X (two copies of W), GCC2X (two copies of GCC), GCC3X (three copies of GCC) and S2X (two copies of S) (Figure 1) with a -46 region minimal promoter of CaMV 35S (Benfey et al., 1989; Sunda- resan et al., 1995) were synthesized at GENEART, Regenburg, Germany. A promoter-probe vector (pRR21) with SgfpS65T reporter gene (pRR21) was constructed and functionally tested by constructing pRR20 which contained CaMV 35S promoter in pRR21 (Raveendra et al., 2009). W2X, GCC2X, GCC3X and S2X synthetic promoters were cloned into HindIII and PstI sites of pRR21 separately to get pRR32, pRR33, pRR34 and pRR35, respectively. A. tumefaciens LBA4404 carrying various synthetic promoters were used for tobacco leaf disc transformation by following the protocol described by Hooykas and Schilperoort (1992) with minor modifications. Plants regenerated on media containing hygromycin.

Figure 1 Sequence of synthetic promoters

PCR confirmation of transgenic tobacco plants

DNA was extracted from putative transgenic tobacco plants carrying the construct pRR32, pRR33, pRR34, pRR35 and pRR20 by rapid DNA isolation method (Sambrook and Russell, 2001) and they were confirmed by PCR with SgfpS65T-specific primers (RB74_GFP_F: 5' AACTCCAGCAGGACCATGTGAT 3' and RB74_GFP_R: 5' ACTTCTTCAAGTCCGCCATG 3'). (Figure 2).

Figure 2 PCR confirmation of the transgenic tobacco plants with SgfpS65Tspecific primers

Expression analysis of synthetic promoters

Induction of the synthetic promoters with salicyclic acid and methyl jasmonate

The induction of the synthetic promoters was tried by spraying at least two PCR positive plants separately with salicyclic acid (SA, Sigma Aldrich #S5922-100G, 5 mM) and methyl jasmonate (MeJ, Sigma Aldrich # 097K3401, 5 mM) hormones.

SgfpS65T expression

Leaf samples taken at regular interval after spray (5 min, 1 h, 2 h, 3 h, and 7 h) were observed under stereo-microscope (Olympus, SZX-16 research stereo-microscope system fluorescence version), aided with GFP filter, objective of 1X (SDF PLAPO 1XPF) and eye piece of WHSZ 10X–H/22 with an exposure time of 200 milli sec. Images of SgfpS65T expressing tissues were captured by the Olympus DP 71 inbuilt camera with the DP Manager software. Three microscopic field images were captured per sample. Images of SgfpS65T expressing tissues were analysed using the software ImageJ. The graphical data at 7 hr after induction with MeJ and SA was converted to the numerical data on promoter strength in terms of range of SgfpS65T intensity (units of apparent brightness) and number of peaks (spots) expressing SgfpS65T.

Results

Development of transgenic tobacco with synthetic promoters

Tobacco leaf discs co-cultivated with Agrobacterium tumefaciens LBA4404 carrying pRR32 (W2X+ SgfpS65T), pRR33 (GCC2X+SgfpS65T), pRR34 (GCC3X+SgfpS65T), pRR35 (S2X+SgfpS65T) and pRR20 (CaMV 35S+SgfpS65T) produced callus within 3-4 weeks, and then shoots in 2 weeks. Around 50~60 calli were produced per construct. Green shoots surviving hygromycin selection were transferred to rooting medium, and well rooted shoots were transferred to sterilized peat for prehardening and after 15-20 days they were grown in green house. Of the 39, 20, 22, 13 and 37 putative transgenic tobacco plants containing W2X, GCC2X, GCC3X, S2X and CaMV 35S promoters, respectively, only 22, 9, 13, 8 and 20 were positive for SgfpS65Tspecific PCR (Figure 3).

Figure 3 SgfpS65T expression activated by synthetic promoters in response to SA

Expression analysis of synthetic promoters

Hormonal induction

Leaf tissues collected from the PCR confirmed tobacco plants were checked for SgfpS65T expression on 15^th day of their establishment. Only the plants transformed with pRR20 showed SgfpS65T expression, indicating that SgfpS65T reporter gene cassette was functional with CaMV 35Spromoter. However, none of the plants transformed with pRR32, pRR33, pRR34 and pRR35 showed SgfpS65T expression, indicating that W2X, GCC2X, GCC3X and S2X promoters were not induced in the absence of hormones, and also there was no background fluorescence. Two plants for each of the promoters were sprayed with 5 mM concentration of SA and MeJ separately, and the observations on SgfpS65T expression were made after 5 min, 1, 2, 3 and 7 hr. Among the four promoters, GCC2X and S2X were induced by both SA and MeJ. However, W2X was induced by SA, but not by MeJ, indicating elicitor/hormone specificity. Both SA and MeJ could not induce GCC3X promoter among the plants tested. Whenever there was expression, number of spots showing SgfpS65T increased with time.

Strength of induction

Considerable variation was found among the synthetic promoters for both the range of SgfpS65T intensity and number of peaks corresponding to SgfpS65T expression. Plants containing CaMV 35S-driven SgfpS65T showed a range of 140~200 for SgfpS65T intensity. Maximum number of peaks (20-22) corresponding to SgfpS65T expressing spots were also obtained for these plants. In general, the range for intensity of SgfpS65T and the spots showing SgfpS65T were more with MeJ treated plants compared to SA sprayed ones, indicating that MeJ could induce more SgfpS65T transcripts and protein in a single cell or a few group of cells, in addition to inducing more number of cells to express SgfpS65T. Though GCC2X and S2X were induced by MeJ, intensity of SgfpS65T was more with GCC2X. There was no difference in the spots showing intensity of SgfpS65T expression. Since W2X and GCC3X were not induced by MeJ, they did not show any intensity of SgfpS65T in any region of three microscopic fields. Among the three promoters (W2X, GCC2X and S2X) induced by SA, intensity was more (130) with W2X and GCC2X compared to S2X (100) (Table 1). But S2X could induce SgfpS65T expression in more number of spots compared to W2X and GCC2X. GCC2X being induced by both the signalling molecules, the intensity was more with MeJ, whereas SgfpS65T peaks were relatively more with SA. However, S2X (another promoter induced by both the hormones), showed almost same number of peaks with both MeJ and SA, whereas SgfpS65T intensity was relatively high with SA. However, colour intensity of SgfpS65T driven by CaMV35S was more compared to the synthetic promoter used in the study.

Table 1 Strength of synthetic promoters in response to SA and MeJ

Discussion

cis-acting elements located in the promoters regulate the pathogen-responsive expression of several genes. These elements are known to contribute to complex expression profiles. For example, members of EAS gene family, coding for sesquiterpene cyclase gene in tobacco are induced by SA and MeJ. However, they are differentially regulated such that each one gene member is expressed in leaves, another in stems, and yet another in roots (Yin et al., 1997). Thus, most of the inducible promoters exhibit organ specificities (Keller et al., 1999). Therefore, one strategy to overcome this complexity is to produce synthetic promoters containing only defined individual elements, thereby reducing expression profile complexity (Salinas et al., 1992). Because of the modular nature of plant promoters, synthetic promoters can be constructed by putting together one or more elements.

Tobacco leaf discs co-cultivated with Agrobacterium tumefaciens LBA4404 produced 22, 9, 13, 8 and 20 transgenic tobacco plants for W2X, GCC2X, GCC3X, S2X and CaMV 35S promoters, respectively. Leaf tissues collected on 15^th day of their establishment were checked for SgfpS65T expression. Only the plants transformed with pRR20 showed SgfpS65T expression, indicating that CaMV 35S promoter-driven SgfpS65T reporter gene cassette was functional. None of the plants transformed with pRR32, pRR33, pRR34 and pRR35 showed SgfpS65T expression, indicating that there was no background fluorescence. However, lack of background emission could be due to restricted copy number of boxes; maximum of two for W and S boxes, and three for GCC. Though the phenolics present in the leaf tissues are known to produce similar fluorescence as that of SgfpS65T tobacco (Imlau et al., 1999), it was not observed in the present study. The overall lack of background fluorescence critically proved that synthetic promoters (with cis-acting elements and minimal promoter) are not induced in the absence of hormones. The important criterion for an efficient pathogen-inducible promoter is that it should be active only when it is exposed to pathogen or elicitor

The Synthetic promoters with multiple repeats (4 or 8) of pathogen-responsive boxes caused higher background fluorescence (Rushton et al., 2002). Tetramers of W, GCC and S boxes showed inducibilities of 5-30 fold, whereas four copies of box S had a remarkably high inducibility (400 fold), which was attributable to an almost complete lack of expression in the absence of pep25 (oomycete-derived peptide elicitor) (Rushton et al., 2002). Although box S is very similar in sequence to the GCC, JERE, and DRE boxes, they appear to direct different patterns of gene expression. Among three S-related boxes, GCC is stronger than box S but showed greatly reduced inducibility by pep25, indicating an increase in the background expression. Synthetic promoters with multiple cis-acting elements are also known to drive reporter gene even in the absence of elicitor (Rushton et al., 2002). Such a condition could be as lethal to the plant as that of genes expressed with a constitutive promoter. Therefore, an efficient pathogen-inducible promoter is the one which is driven only when the plant is exposed to pathogen or elicitor.

Synthetic promoters were tested for induction upon treatment with the secondary signaling molecules (SA and MeJ) involved in disease resistance.Pepper seedlings treated with with 5 mM salicylic acid could strongly induce CALTPI corresponding to pepper lipid transfer protein (LTP) after 24 hr. Transcription of three CALTP genes were also up-regulated by infecting the leaves with Xanthomonas campestris pv. Vesicatoria (Jung et al., 2003). However, tobacco plants sprayed with 10 mM of SA and MeJ in this study, showed severe withering, resulting in inability to collect the leaf samples for observation. Therefore, SA and MeJ were sprayed at a lesser concentration (5 mM).

Whenever there was expression, number of spots showing SgfpS65T increased with time. GCC2X and S2X were induced by both SA and MeJ indicating specific signal transduction leading to activation of promoters by hormones. S box in the promoters of ELI7 gene family of parsley (Petroselinum crispum) is transcriptionally activated following treatment with an elicitor derived from the phytopathogen Phytophthora sojae (Kirsch et al., 2000). However, W2X was induced by SA, but not by MeJ, indicating elicitor/hormone specificity. Induction of W box containing promoter could be through the activation of WRKY transcription factors (Salzman et al., 2005), and pep25 (Rushton et al., 1996). Previous studies have shown that W box responds to SA (Yang et al., 1999), whereas GCC box responds to ethylene (Ohme-Takagi and Shinshi, 1995) and MeJ (Menke et al., 1999; van der Fits and Memelink, 2000). S box being similar to GCC, might be induced by both MeJ and ethylene. Response of GCC box to MeJ could be due to enhanced levels of transcription factors binding to it. Activation of GCC box is also found to involve jasmonate/ethylene-mediatedrather than SA-dependent signalling pathway (Penninckx et al., 1998; Penninckx et al., 1996). However, this study showed that GCC2X promoter is induced not only by MeJ, but also with SA. In general, it was found that restricting the copy number of cis-elements did not affect inducibility, but could avoid background expression.

Whenever there was expression, the number of spots showing SgfpS65T increased with time. The activation of the promoter in adjacent cells could be due to the direct exposure to hormone or indirectly because of the spread of induced internal signal(s). Leaf tissues from two transgenic plants containing GCC3X promoter were not induced by either SA or MeJ. It could be due to position effect of the transgene (GCC3X+SgfpS65T+Nos T) or various transcriptional/post-transcription gene silencing mechanisms (Bhat and Srinivasan, 2002; Butaye et al., 2005). Homology-dependent gene silencing (HDGS) is of great concern in plant genetic engineering strategies and is thought to be caused by multiple copies of homologous transgene and promoter sequences (Matzke et al., 2002). Repetitive use (three copies) of cis-elements with identical core-sequences and homologous intervening regions (within a functional domain) might also cause depletion of transcription factors, consequently reducing endogenous gene expression (Bhullar et al., 2003). Therefore, design strategies using multimers of cis-motifs need to be optimized to achieve the desirable inducibility of the transgene. Though spacer sequence between individual cis-acting elements and/or between these elements and the pre-initiation complex can also have a profound effect (Wray, 1998), this factor could be ruled out as the cause for non-induction of GCC3X since GCC2X containing the same spacers was active. It is the length but not the sequence of the spacing between two boxes that would have a significant effect on the strength as well as inducibility of the promoter (Rushton et al., 2002).

Three randomly taken microscopic images of leaf tissues were analysed for differential colour intensity using the dynamic profiler plugin of the ImageJ software. The images were depicted graphically by plotting the intensity of the colours against the distance covered along the image. The graphical data at 7 hr after induction with MeJ and SA was converted to the numerical data on promoter strength in terms of range of SgfpS65T intensity and number of peaks for SgfpS65T expression. Considerable variation was found among the synthetic promoters for both the range of SgfpS65T intensity and number of peaks corresponding to SgfpS65T expression. With SA, the strength of induction of W2X and GCC2X promoters were comparable and relatively higher than S2X. Similarly, GCC2X and S2X had similar magnitude of induction with MeJ. In general, the synthetic promoters were more strongly induced by SA compared to MeJ, and the extent of induction was less compared to that of CaMV 35S promoter. Though the extent of induction is important for a promoter, optimum rate of activation needs to be tested with a gene for disease resistance.

References

Anderson, J.P., L.F. Thatcher, and K.B. Singh, 2005: Plant defence responses: conservation between models and crops. Funct Plant Biol 32, 21-34
http://dx.doi.org/10.1071/FP04136

Benfey, P.N., L. Ren, and N.H. Chua, 1989: The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J 8, 2195-2202

Bhat, S.R., and S. Srinivasan, 2002: Molecular and genetic analyses of transgenic plants: Considerations and approaches. Plant Sci 163, 673-681
http://dx.doi.org/10.1016/S0168-9452(02)00152-8

Bhullar, S., S. Chakravarthy, S. Advani, S. Datta, D. Pental, and P.K. Burma, 2003: Strategies for development of functionally equivalent promoters with minimum sequence homology for transgene expression in plants: cis-elements in a novel DNA context versus domain swapping. Plant Physiol 132, 988-998
http://dx.doi.org/10.1104/pp.103.020602

Butaye, K.M.J., B.P.A. Cammue, S.L. Delauré, and M.F.C. De Bolle, 2005: Approaches to minimize variation of transgene expression in plants. Mol Breed 16, 79-91
http://dx.doi.org/10.1007/s11032-005-4929-9

Coutos-Thevenot, P., B. Poinssot, A. Bonomelli, H. Yean, C. Breda, D. Buffard, R. Esnault, R. Hain, and M. Boulay, 2001: In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen-inducible PR 10 promoter. J Exp Bot 52, 901-910
http://dx.doi.org/10.1093/jexbot/52.358.901

Eulgem, T., P.J. Rushton, E. Schmelzer, K. Hahlbrock, and I.E. Somssich, 1999: Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18, 4689-99
http://dx.doi.org/10.1093/emboj/18.17.4689

Fischer, R., I. Budde, and R. Hain, 1997: Stilbene synthase gene expression causes changes in flower colour and male sterility in tobacco. Plant J 11, 489-498
http://dx.doi.org/10.1046/j.1365-313X.1997.11030489.x

Gurr, S.J., and P.J. Rushton, 2005: Engineering plants with increased disease resistance: how are we going to express it? Trends Biotechnol 23, 283-90 http://dx.doi.org/10.1016/j.tibtech.2005.04.007
http://dx.doi.org/10.1016/j.tibtech.2005.04.009

Hooykaas, P.J.J., and R.A. Schilperoort, 1992: Agrobacterium and plant genetic engineering. Plant Mol Biol 19, 15-38
http://dx.doi.org/10.1007/BF00015604

Imlau, A., Truernit, E. and Sauer, N., 1999, Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell, 11 (3): 309-322
http://dx.doi.org/10.2307/3870862
http://dx.doi.org/10.1105/tpc.11.3.309

Jung, H., Kim, W. and Hwang, B. K., 2003, Three pathogen-inducible genes encoding lipid transfer protein from pepper are differentially activated by pathogens, abiotic and environmental stresses. Plant Cell Environ., 26 (6): 915-928
http://dx.doi.org/10.1046/j.1365-3040.2003.01024.x

Keller, H., Pamboukdjian, N., Ponchet, M., Poupet, A., Delon, R., Verrier, J.-L., Roby, D. and Ricci, P., 1999, Pathogen-Induced Elicitin Production in Transgenic Tobacco Generates a Hypersensitive Response and Nonspecific Disease Resistance. Plant Cell, 11 (2): 223-236 http://dx.doi.org/10.2307/3870852
http://dx.doi.org/10.1105/tpc.11.2.223

Kirsch, C., Takamiya-Wik, M., Schmelzer, E., Hahlbrock, K. and Somssich, I. E., 2000, A novel regulatory element involved in rapid activation of parsley ELI7 gene family members by fungal elicitor or pathogen infection. Mol. Plant Pathol., 1 (4): 243-251
http://dx.doi.org/10.1046/j.1364-3703.2000.00029.x

Matzke, M.A., W. Aufsatz, T. Kanno, M.F. Mette, and A.J. Matzke, 2002: Homology-dependent gene silencing and host defense in plants. Adv Genet 46, 235-75
http://dx.doi.org/10.1016/S0065-2660(02)46009-9

Menke, F.L.H., A. Champion, J.W. Kijne, and J. Memelink, 1999: A novel jasmonate-and elicitor-responsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate-and elicitor-inducible AP2-domain transcription factor, ORCA2. EMBO J 18, 4455-4463
http://dx.doi.org/10.1093/emboj/18.16.4455

Ohme-Takagi, M., and H. Shinshi, 1995: Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7, 173-82 http://dx.doi.org/10.1105/tpc.7.2.173
http://dx.doi.org/10.2307/3869993

Penninckx, I., B. Thomma, A. Buchala, J.P. Metraux, and W.F. Broekaert, 1998: Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10, 2103-2114
http://dx.doi.org/10.2307/3870787
http://dx.doi.org/10.1105/tpc.10.12.2103

Penninckx, I., K. Eggermont, F.R.G. Terras, B. Thomma, G.W.D. Samblanx, A. Buchala, J.P. Metraux, J.M. Manners, and W.F. Broekaert, 1996: Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8, 2309-2323
http://dx.doi.org/10.2307/3870470
http://dx.doi.org/10.1105/tpc.8.12.2309

Raveendra, G.M., R.S. Bhat, S. Bhat, and M.S. Kuruvinashetti, 2009: Construction and functional validation of a new promoter-probe vector (pRR21). Curr Sci 96

Rushton, P.J., A. Reinstadler, V. Lipka, B. Lippok, and I.E. Somssich, 2002: Synthetic plant promoters containing defined regulatory elements provide novel insights into pathogen-and wound-induced signaling. Plant Cell 14, 749-762
http://dx.doi.org/10.1105/tpc.010412

Rushton, P.J., J.T. Torres, M. Parniske, P. Wernert, K. Hahlbrock, and I.E. Somssich, 1996: Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J 15, 5690-5700

Salinas, J., Oeda, K. and Chua, N. H., 1992, Two G-box-related sequences confer different expression patterns in transgenic tobacco. Plant Cell, 4 (12): 1485-1493
http://dx.doi.org/10.2307/3869492
http://dx.doi.org/10.1105/tpc.4.12.1485

Salzman, R. A., Brady, J. A., Finlayson, S. A., Buchanan, C. D., Summer, E. J., Sun, F., Klein, P. E., Klein, R. R., Pratt, L. H., Cordonnier-Pratt, M. M. and Mullet, J. E., 2005, Transcriptional profiling of sorghum induced by methyl jasmonate, salicylic acid, and aminocyclopropane carboxylic acid reveals cooperative regulation and novel gene responses. Plant Physiol., 138 (1): 352-368
http://dx.doi.org/10.1104/pp.104.058206

Scheideler, M., N.L. Schlaich, K. Fellenberg, T. Beissbarth, N.C. Hauser, M. Vingron, A.J. Slusarenko, and J.D. Hoheisel, 2002: Monitoring the switch from housekeeping to pathogen defense metabolism in Arabidopsis thaliana using cDNA arrays. J Biol Chem 277, 10555-61
http://dx.doi.org/10.1074/jbc.M104863200

Sundaresan, V., P. Springer, T. Volpe, S. Haward, J.D. Jones, C. Dean, H. Ma, and R. Martienssen, 1995: Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev 9, 1797-810
http://dx.doi.org/10.1101/gad.9.14.1797

Van der Fits, L., and J. Memelink, 2000: ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism, 295-297, Vol. 289

Wray, G.A., 1998: Promoter logic. Science 279, 1896-902 http://dx.doi.org/ 10.1126/science.279.5358.1871

Yang, P., C. Chen, Z. Wang, B. Fan, and Z. Chen, 1999: A pathogen-and salicylic acid-induced WRKY DNA-binding activity recognizes the elicitor response element of the tobacco class I chitinase gene promoter. Plant J 18, 141-149
http://dx.doi.org/10.1046/j.1365-313X.1999.00437.x

Yin, S., Mei, L., Newman, J., Back, K. and Chappell, J., 1997, Regulation of sesquiterpene cyclase gene expression (characterization of an elicitor- and pathogen-inducible promoter). Plant Physiol., 115(2): 437-451
http://dx.doi.org/10.1104/pp.115.2.437

Molecular Plant Breeding

• Volume 4

View Options
. PDF(142KB)
. FPDF
. HTML
. Online fPDF
Associated material
. Readers' comments
Other articles by authors
. S.B. Yeri

. R.S. Bhat

. M.S. Kuruvinashetti