Introduction

Rice is the staple food which serves as the chief source of dietary carbohydrates for more than 85% Indian population. Regular consumption of rice increases the risk of developing type II diabetes due to increased blood glucose level (Barclay et al., 2008). By 2030, about 330 million people all over the world are expected to be affected by diabetes and India is certain to have the greatest increase. In India, there are nearly 50 million diabetics, according to the statistics of the International Diabetes Federation. Presently, nearly one million Indians die due to diabetes every year. Maintenance of blood glucose level is required for normal brain function. Its build up ≥3.3 mmol/l in the blood stimulates brain to signal pancreas for secretion of more insulin to convert excess sugar into stored fat (Thorens, 2011). But, patients suffering from diabetes fail to secrete required amount of insulin making them more vulnerable to the dreadful diabetic problems. In this context, brown rice proved to be protective but not preferred by most consumers for its shorter shelf-life, longer cooking time and unappealing taste and texture (Zhang et al., 2010). Individuals served with cooked brown rice twice in a week, can reduce their chances of developing type II diabetes by up to 11%. On the other hand, consumption of white sticky rices (polished rice) stimulates adverse metabolic affectand increases the risk of acquired blindness, renal failure, colon cancer and cardiovascular diseases. Therefore, these are unsuitable in a healthy diet.

1 Amylose Content and Glycemic Index (GI)

Carbohydrate component of food is an essential part of our daily nutrition. It serves as the prime source of energy. Carbohydrate stored in endosperm of rice seed is in form of starch (80-90%). This is made of two polysaccharides (glucan polymers) i.e., linear amylose and branched amylopectin. Amylose is hard to digest compared with amylopectin. Therefore, percentage of amylose in total starch, measured as Apparent Amylose Content (AAC), is the key determinant of rice cooking properties. Based on amylose content, rice varieties are classified as waxy (0–5%), very low (5–12%), low (12–20%), intermediate (20–25%), and high (25–33%) (Suwannaporn et al., 2007). Digestion of starch normally begins with salivary α-amylase followed by additional hydrolysis by pancreatic amylase secreted to the small intestine. The ultimate blood glucose level depends on the amount and physicochemical properties of starch in cooked rice, rate of hydrolysis of starch to glucose and rate of absorption to blood. Rice varieties possessing slowly digestible starch (high amylose, low glycemic index) can be useful for management of dreadful diabetic problems. On the other hand, lower amylose containing starches are readily hydrated and highly gelatinized upon heating. This facilitates easy hydrolysis of starch by α-amylase and greater tendency to raise blood sugar levels. In other words, starch with lower amylose content has higher Glycemic Index(GI) (Rathinasabapathi et al., 2015). Therefore, biosynthesis pathway that allows more synthesis of amylose than amylopectin is desirable. GI is the response of a 50 g carbohydrate portion of food expressed as a percentage of that of a standard. This requires measurement of area under blood glucose curve (AUC) of fasting blood samples followed by half-hourly samples for two hours after feeding cooked rice equivalent to 50g carbohydrate. Thus, GI (%) = (AUC of test food)/(AUC of glucose as reference food) x 100. Any variety of rice with GI less than or equal to 55 is considered diabetic-friendly. Different varieties of rice have variable GI (48-92%) (Fitzgerald et al., 2011) owing to varying levels of amylose content. Indian Institute of Rice Research, Hyderabad has identified three rice varieties e.g. Lalat, BPT 5204 and Sampada with low GI values. Some Australian, Indonesian, Indian and Bangladeshi varieties have been reported to have lower GI than other rices. Notable among these are the amylose heavy basmati type rices and the mega rice variety “Swarna” showing low GI, while IR 65 is a waxy variety which contains no amylose (highest GI) (Fitzgerald et al., 2011). Amylose structure affects the GI and that the firm-textured varieties in general have a lower GI. Parboiled red raw rice has GI as low as 56 in case of var. By 350 due to high non-starch polysaccharide (fibre) content. Low GI foods are reported to reduce the risk of coronary heart disease (Frost et al.,1999), obesity (Slabber, 1994) and exhaustion during sports (Walton and Rhodes, 1997).

GI of rice is increased upon hydration and boiling for longer time as a result of gelatinization of starch. Similarly puffed product of rice increases the GI by 15-20% (Montignac, 2015).In contrast, cooling and drying of cooked rice reduce the GI due to reorganization of amylose and amylopectin making the starchy product more complex. On the other hand, rice flour being easy to hydrolyse by digestive enzymes, has higher GI than whole rice. In some cases, protein and fibres are associated with starch making it more complex, slower rate of digestion and lower GI score.

Several methods including iodine binding, near infrared spectroscopy, size-exclusion chromatography and most recently, asymmetric field flow fractionation (Chiaramonte et al., 2012) are now available for determination of amylose content. Among these, the iodine binding method has been validated for routine use (Fitzgerald et al., 2009). Many often, phenotyping based on any of these methods becomes misleading owing to the effect of high temperature during grain development, modifier genes and cytoplasmic factors (Kumar and Khush, 1987). However, molecular markers associated with the key enzymes for starch biosynthesis could be a viable alternative to assess amylose status in rice. Thus, the above informations clearly elucidate the genetic basis of amylose content and GI status in rice.

2 Genetic Basis of Glycemic Index and Allele Mining

GI is a complex trait. Large variability in GI, ranging from low to high GI, was found using a set of 235 varieties (Fitzgerald et al., 2011). GI of rice is shown to have negative relationship with amylose content. Therefore, genetic basis of amylose content can elucidate GI status in rice.   In fact, at least 18 highly polymorphic starch biosynthesis related genes contribute directly or indirectly to the GI by altering the amylose and amylopectin content in rice (Kharabian-Masouleh et al., 2012). Waxy mutants containing amylose-free starch have been isolated from many plant species. In fact, a multiallelic waxy gene (Wx) encoding Granule-Bound Starch Synthase I (GBSS I :60kDa) determines amylose content in rice endosperm (Mikami et al., 2008). It is located on chromosome 6 and consists of 13 exons and 12 introns. Exploring sequence variation (allele mining) of this key gene can unravel novel alleles for use in breeding programme. Eco-tilling is found to be useful to explore the presence of sequence variation and detection of SNPs in the waxy gene (Hoai et al., 2014; Biselli et al., 2014). Biselli et al., (2014) sequenced the GBSSI gene as well as 1kbp of the upstream putative regulatory region of twenty-one genotypes representing all the AAC classes in order to mine the genetic variation. The genome of Swarna (Low GI) was mapped to high GI (85%) Japonica rice variety “Nipponbare” as reference genome (Butardo et al., 2011). Rice waxy mutants have no detectable AAC owing to presence of a premature termination codon in the transcriptional product of the waxy gene (Wanchana et al., 2003). Two wild type waxy alleles,Wx^a and Wx^b specific to indica and japonica subspecies cause high and low AAC respectively (Dobo et al., 2010). Expression level of mRNA and accumulation of waxy protein in Wx^a cultivars is 10-fold higher than that of Wx^b cultivars (Isshiki et al., 1998). The SNP involving substitution of G to T at the splicing donor site (AGGTATA to AGTTATA) of the first intron is designated as Wx^b allele which decreases expression level of the GBSS gene resulting low AAC (Hoai et al., 2014). Among different waxy alleles; wx (recessive) allele is reported to be associated with highest GI (lowest amylose) while, the Wx^a (wild) allele reveals the lowest GI (highest amylose). In fact, the SNPs at intron1 and exon 6 of GBSS1 are able to explain a maximum of 79.5% of AAC variation (Biselli et al., 2014). It was found that T/G SNP at position 246,‘A’ at position 2,386, and ‘C’ at position 3,378 in the GBSS I gene, and C/T SNP at position 1,188 in the glucose-6-phosphate translocator (GPT) gene may contribute to the low GI phenotype in Swarna from India (GI score 60) and Fedearroz (GI score 50) from Columbia. (Larking and Park, 2003) identified presence of Wx^op, Wxⁱⁿ, Wx^mq, Wx^hp and wx alleles in different rice varieties using sequence data of exons 4, 6, 5, 2 and 10 of GBSS I. An SNP in exon 6(A to C substitution) identified  as Wxⁱⁿ allele in isogenic lines brings about amino acid substitution from serine to tyrosine (Chen et al., 2008) and results shift in amylose content of the grain from high to intermediate levels (Mikami et al., 2008). Rice varieties with opaque endosperm  show very low amylose (<9%) due to less activity of GBSS l than even low amylose varieties (Mikami et al., 1999; Mikami et al., 2008) identified an SNP in exon 4 (Wx^op allele) associated with the opaque phenotype which results amino acid substitution of aspartate to Glycine. Low amylose content (< 8%) in most of the tropical glutinous rice is associated a 23-bp duplicated sequence in exon 2 which creates a premature stop codon at 78bp downstream of the repeated sequence (Wanchana et al., 2003). Jeng et al., (2009) detected the 23bp duplication in exon 2 in all 35 NaN3-induced waxy mutants derived from rice genotype Tainung 67 following. Further, a deletion mutation in the Wx gene is shown to be fatal to activity of GBSS l (Mikami et al., 1999) resulting no biosynthesis of amylose as in IRIS 6-59997(Fitzgerald et al., 2011). Besides, the range of AAC within each of the erstwhile mentioned five classes suggest the influence of other genes or genetic background. Thus, understanding the genetic basis of high amylose content in candidate rice varieties will help in developing low GI rice genotypes to combat diabetic problems.

3 Identification of Molecular Markers

Different allelic variations in the major candidate genes related to starch biosynthesis paves the way for development of potential molecular markers linked to different classes of amylose content. The association between AAC and single-nucleotide polymorphisms (SNPs) in the rice Wx gene has been detected at the splicing donor sites of the intron 1 (Isshiki et al., 1998), exon 4 (Mikami et al., 2008), exon 6 (Larkin and Park, 2003; Mikami et al.,2008), and exon 10 (Cai et al., 1998; Mikami et al., 2008). The SNPs  identified on fourth, sixth and tenth exon of the GBSS I gene are at 2016(A to C substitution), 2385 (A to C substitution) and 3377(C to T substitution) position from ATG starting site which resulted non-synonymous changes from Asp to Gly, from Tyr to Ser, and from Pro to Ser, respectively (Hoai et al., 2014). Similarly, another SNP linked to amylose content comprised C to T substitution at 3013 position on nineth exon which revealed synonymous change in amino acid. Cultivars with low amylose had the C SNP in exon 10, whereas all the cultivars with inter mediateand high amylose was reported to have the T SNP in exon 10(Hoai et al., 2014).The primer pairs designed to identify the above SNPs onm exon 4-10 are F:5′-TAGCCGAGTTGGTCAAAGGA-3′, R:5′-AAGCACAGGCTGGAGAAAT-3′ and F:5′-TCGCATTGGATGGATGTGTA3’, R:5′-GCATAAAACAAAAATGGCATGG-3′ (Hoai et al., 2014). Besides, very low amylose varieties could be determined by genotyping the SNP on exon 4 (A/G) using the primer set (F: 5-TGC TAC AAG CGT GGA GTG GA-3 and R :5-ACC AGTACA AGG ACG CTT GG-3) and sequencing of the product (Fitzgerald et al., 2011). The erstwhile mentioned SNP at the splicing donor site of intron 1 is due to substitution of G by T (Wx^b allele- low amylose)and it can be identified by allele specific primer pair F: 5′- CCATTCCTTCAGTTCTTTGTCT-3′ and R: 5′-CACTGACCTGGCAAAGAAGG-3′). The primer pair can amplify the fragment containing the first exon–intron junction of the Waxy gene (Hoai et al., 2014).

Recently, several SNP alleles at regulatory region (1514 G/T promoter) and functional regions (T/G intron 1, 1801 T/C exon 9, 2282 A/G intron 10 and 2806 C/T intron 12) of the GBSS I locus have been identified (Biselli et al., 2014). In this context, dCAPS (derived cleaved amplified polymorphic sequence-Yamanaka et al., 2004) primers have been designed to detect SNP for T/G polymorphism (Rathinasabapathi et al., 2015) in intron 1 which explain 77.5% of the total variation in amylose content (Biselli et al., 2014). The dCAPS technique introduces or destroys restriction enzyme recognition sites by using primers that contain one or more mismatches to the template DNA. The PCR product modified in this manner is then subjected to restriction enzyme digestion and the presence or absence of the SNP is determined by the resulting restriction pattern. All primers are designed using the Primer3 0.4.0 software (http://frodo.wi.mit.edu/ webcite) and blasted against the rice genomic sequence on the Gramene website (http://www.gramene.orgwebcite) to ensure the specificity for the GBSSI gene. In this context, the G-to-T substitution at the 5’ leader intron splice donor site of the Wx alleles can be detected by  using the primer pair F:5’TGTTGTTCATCAGGAAGAACATCTCCAAG-3’ and R: 5’-TTAATTTCCAGCCCAACACC-3’ which generate a unique EcoT14I restriction site characteristic of the Wxa allele. Besides, RM190 (CTn) is identified as the closely linked microsatellite marker to GBSSI which can explain more than 80% AAC variation (Dobo et al.,2010). The RM 190 CT repeat primer was designed using the M13-tailed forward primer RM-190 F (CACGACGTTGTAAAACGA CCTTTGTCTATCTCAAGACAC) and the reverse primer RM-190R (TTGCAGATGTT CTTCCTGATG) (Chen et al., 2008).  Three CT allele variants e.g., CT9, CT10, CT14are associated with 23–24.85% AAC (Tan and Zhang, 2001), while CT11 and CT20 identified accessions with AAC higher than 25%(Biselli et al., 2014). However, (Temnykh et al., 2000) used the primer pair RM-190F (5’-CTTTGTCTATCTCAAGACAC-3’) and RM-190R (5’ -TTGCAGATGTTCTTCCTGATG-3’) for genotyping the RM190 microsatellite CTn alleles.(Fitzgerald et al., 2011) identified three SNPs on the exon 1, 4 and 6 at the Waxy locus. The SNP for G/T at exon 1 was determined by amplifying a region by primer pair RM190 followed by a restriction enzyme “Acc1” (Ayres et al., 1997). Similarly, the G/T polymorphism in intron 1 of the Waxy gene (In1G and In1T alleles) was genotyped by restriction digest of the PCR fragment of the region amplified  by forward primer RM-190F :5’-CTTTGTCTATCTCAAGACAC-3’) and reverse primer GBSS-W2R :5’-TTTCCAGCCCAACACCTTAC-3’) (Ayres et al., 1997).  The presence of G and T at the site signifies high or intermediate amylose, and low amylose status respectively. In fact, haplotypes 8G(identified by RM 190 -CT8 allele), 10G and 11G are associated with the high AAC-types; haplotypes 14G, 16G, 17G, 18G, 19G and 20G are found in the intermediate AAC-types. Whereas, haplotypes 17T, 18T, and 19T are in the low AAC-types (Chen et al., 2008). Very low amylose varieties are also associated with SNP on exon 4 (A/G) which can be identified by the primer pair  F: 5′- TGC TAC AAG CGT GGA GTG GA-3′ and R: 5′-ACC AGT ACA AGG ACG CTT GG-3’). Intermediate and high amylose varieties were genotyped by SNP status at exon 6 (A/C) using allele-specific primers (5’-CCC ATA CTT CAA AGG AAC ATA-3′, 5- GGT TGG AAG CAT CAC GAG TT– 3 and 5’- TCT TCA GGT AGC TCG CCA GT – 3’), where a product size of 292 bp indicates C (intermediate amylose) and products of 200 and 292 bp identify an A (high amylose). Hence, these molecular markers may be utilized in masker assisted breeding to develop low GI rice varieties.

Several new SNPs now available by re-sequencing of the Waxy gene and its 1kbp upstream regulatory region (Biselli et al., 2014). A combination of the CT20 allele of RM190 in combination with the A haplotype for exon 6 and the G haplotype for SNP at 1,514 was always associated to an AAC higher than 24.5%, thus providing an efficient tool for selecting high AAC rice accessions. The combination of two SNPs in the Waxy gene, including a single G/T polymorphism at the splicing donor site of the first intron and an SNP in exon 6 potent enough to differentiate all three classes of low, intermediate, and high AAC (Chen et al., 2008). These can be effectively used to assist breeding programme for development of rice variety with high glycemic index.

References

Ayres N.M., Mcclung A.M., Larkin P.D., Bligh H.F.J., Jones C.A., and Park W.D., 1997, Microsatellites and a single-nucleotide polymorphism differentiate apparent amylase classes in an extended pedigree of US rice germplasm, Theor&Appl. Genet., 94(6):773-781

http://dx.doi.org/10.1007/s001220050477

Barclay A.W., Petocz P., McMillan-Price J., Flood V.M., Prvan T., Mitchell P., and Brand-Miller J.C., 2008, Glycemic index, glycemic load, and chronic disease risk—a meta-analysis of observational studies, Journal of Applied Physics, 87(3): 627–37

Biselli C., Cavalluzzo D.,Perrini R.,Gianinetti A.,Bagnaresi P.,Urso S.,Orasen G.,Desiderio F.,Lupotto E.,Cattivelli L.andValè G., 2014, Improvement of marker-based predictability of Apparent Amylose Content injaponicarice throughGBSSIallele mining, Rice, 7(1): 1-18

http://dx.doi.org/10.1186/1939-8433-7-1

Butardo V.M., Fitzgerald M.A., Bird A.R., Gidley M.J., and Flanagan B.M., 2011, Impact of downregulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing, Journal of Experimental Botany, 62(14):267-275

http://dx.doi.org/10.1093/jxb/err188

Cai X.L., Wang Z.Y., Xing Y.Y., Zhang J.L., and Hong M.M., 1998, Aberrant splicing of intron 1 leads to the heterogeneous 5′ UTR and decreased expression of waxy gene in rice cultivars of intermediate amylose content, Plant Journal, 14(4): 459–465

http://dx.doi.org/10.1046/j.1365-313X.1998.00126.xPMid:9670561

Chen M.H., Bergman C., Pinson S., and Fjellstrom R., 2008, Waxygene haplotypes: Associations with apparent amylase content and the effect by the environment in an international rice germplasm collection, Journal of Cereal Science, 47(3):536-545

http://dx.doi.org/10.1016/j.jcs.2007.06.013

Chiaramonte E., Rhazi L., Aussenac T., and White R.D., 2012, Amylose and amylopectin in starch by asymmetric flow field-flow fractionation with multi-angle light scattering and refractive index detection (AF4–MALS–RI), Journal of Cereal Science, 56(2):457-463

http://dx.doi.org/10.1016/j.jcs.2012.04.006

Dobo M., Ayres N., Walker G., and Park W.D., 2010, Polymorphism in the GBSS gene affects amylose content in US and European rice germplasm, Journal of Cereal Science, 52(52):450-456

http://dx.doi.org/10.1016/j.jcs.2010.07.010

Fitzgerald M.A., Bergman C.J., Resurreccion A.P., Möller J., Jimenez R., Reinke R.F., Martin M., Blanco P., Molina F., Chen M.H., Kuri V., Romero M.V., Habibi F., Umemoto T., Jongdee S., Graterol E., Reddy K.R., Zaczuk Bassinello P., Sivakami R., Rani N.S., Das S., Wang Y.J., Indrasari SD, Ramli A, Ahmad R, Dipti SS, Xie L, Lang NT, Singh P, Toro DC, Tavasoli F, Mestres C., 2009, Addressing the dilemmas of measuring amylose in rice, Cereal Chem., 86(5):492-498

http://dx.doi.org/10.1094/CCHEM-86-5-0492

Fitzgerald M.A., Rahman S., Resurreccion A.P., Concepcion J., Daygon V.D., Dipti S.S., Kabir K.A., Klingner B., Morell M.K. and Bir A.R., 2011, Identification of a Major Genetic Determinant of Glycemic Index in Rice, Rice, 4(4):66–74

http://dx.doi.org/10.1007/s12284-011-9073-z

Frost G., Leeds A.A., Doré C.J., Madeiras S., and Dornhorst A., 1999, Glycemic index as a determinant of serum HDL-cholestrol concentration, Lancet, 353(9158): 1045-1048

http://dx.doi.org/10.1016/S0140-6736(98)07164-5

Hoai T.T., Matsusaka H., Toyosawa Y., Suu T.D., Satoh H., and Kumamaru T., 2014, Influence of single-nucleotide polymorphisms in the gene encoding granule-bound starch synthase I on amylose content in Vietnamese rice cultivars, Breeding Science, 64(2): 142–148

http://dx.doi.org/10.1270/jsbbs.64.142

Isshiki M., Morino K., Nakajima M., Okagaki R.J., Wessler S.R., Izawa T. and Shimamoto K., 1998, A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ sp,lice site of the first intron,  Plant Journal, 15(1): 133–138

http://dx.doi.org/10.1046/j.1365-313X.1998.00189.xPMid:9744101

Jeng T.L., Wang C.S., Tseng T.H., Wu M.T., and Sung J.M., 2009, Nucleotide polymorphisms in the waxy gene of NaN3-induced waxy rice mutants, Journal of Cereal Science, 49(1):112–116

http://dx.doi.org/10.1016/j.jcs.2008.07.009

Kharabian-Masouleh A., Waters D.L., Reinke R.F., Ward R., and Henry R.J., 2012, SNP in starch biosynthesis genes associated with nutritional and functional properties of rice, Scientific Reports, 2(8): 2016-2016

http://dx.doi.org/10.1038/srep00557

Kumar I., and Khush G.S., 1987, Genetic-analysis of different amylose levels in rice, Crop Science, 27(6):1167-1172

http://dx.doi.org/10.2135/cropsci1987.0011183X002700060016x

Larkin P.D., and Park W.D., 2003, Association of waxy gene single nucleotide polymorphisms with starch characteristics in rice (Oryza sativaL.), Molecular. Breed., 12(4):335-339

http://dx.doi.org/10.1023/B:MOLB.0000006797.51786.92

Mikami I., Aikawa M., Hirano H.Y., and Sano Y., 1999, Altered tissue-specific expression at the Wx gene of the opaque mutants in rice, Euphytica, 105(2):91–97

http://dx.doi.org/10.1023/A:1003457209225

Mikami I., Uwatoko N., Ikeda Y., Yamaguchi J., Hirano H.Y., Suzuki Y., and Sano Y., 2008, Allelic diversification at thewxlocus in landraces of Asian rice, Tag.theoretical & Applied Genetics.theoretische Und Angewandte Genetik, 116(7):979-989

http://dx.doi.org/10.1007/s00122-008-0729-zPMid:18305920

Montignac, 2015, The Factors that Modify Glycemic Indexes, Official web site of the Montignac Method pp.1-4. URL:http://www.montignac.com/en/the-factors-that-modify-glycemic-indexes/).

Rathinasabapathi P., Purushothaman N., Ramprasad V.L., and Parani M., 2015, Whole genome sequencing and analysis of Swarna, a widely cultivated indica rice variety with low glycemic index, Scientific Reports, 5: 11303

http://dx.doi.org/10.1038/srep11303

Suwannaporn P., Pitiphunpong S., and Champangern S., 2007, Classification of rice amylose content by discriminant analysis of physicochemical properties, Starch-Starke, 59(3-4):171-177.

http://dx.doi.org/10.1002/star.200600565

Slabber M., Bernard H.C., Kuyl J.M., Dannhauser A., and Schall R., 1994, Effect of a low insulin response, energy restricted diet in weight loss and plasma insulin concentration hyperinsulinaemic obese females,American Journal of Clinical Nutrition, 60(1): 48-53

Tan Y., and Zhang Q., 2001, Correlation of simple sequence repeat (SSR) variants in the leader sequence of the waxy gene with amylose of the grain in rice, Acta Botanica Sinica, 43(2):146-150

Temnykh S., Park W.D., Ayres N., Cartinhour S., Hauck N., Lipovich L., Cho Y.G., Ishii T. and McCouch S.R., 2000, Mapping and genome organization of microsatellite sequences in rice (Oryzan sativa L.), Theoretical & Applied Genetics, 100(5): 697-712

http://dx.doi.org/10.1007/s001220051342

Thorens B., 2011, Brain glucose sensing and neural regulation of insulin and glucagon secretion, Diabetes Obes. Metab., 13(Suppl.1):82-88

http://dx.doi.org/10.1111/j.1463-1326.2011.01453.xPMid:21824260

Walton P., and Rhodes D.E.C., 1997, Glycaemic index and optimal sports performance, Sports Medicine, 23(3): 164-72

http://dx.doi.org/10.2165/00007256-199723030-00003

Wanchana S., Toojinda T., Tragoonrung S., and Vanavichit A., 2003, Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.), Plant Science, 165(6): 1193–1199

http://dx.doi.org/10.1016/S0168-9452(03)00326-1

Yamanaka S., Nakamura I., Watanabe K.N., Sato Y.I., 2004, Identification of SNPs in the waxy gene among glutinuous rice cultivars and their evolutionary significance during the domestication process of rice, Theoretical & Applied Genetics, 108(7): 1200–1204

http://dx.doi.org/10.1007/s00122-003-1564-xPMid:14740088

Zhang G., MalikV.S., Pan A., Kumar S., Holmes M., Spiegelman D., Lin X. and Hu F.B., Substituting brown rice for white rice to lower diabetes risk: a focus-group study in Chinese adults, Journal of the American Dietetic Association, 110(8):1216–1221

http://dx.doi.org/10.1016/j.jada.2010.05.004PMid:20656097