Background

Ca²⁺ mainly exists in the binding form in plant cells, which acts as a vital second messenger in cellular signaling and plays an important role in plant stress resistance and adaptation (Dong et al., 2015). When plants suffer from different stresses, not only the intracellular Ca²⁺ concentration is different, but also the distribution of Ca²⁺ in space and time is specific. The phenomenon of producing specific calcium waves in response to different stimulations from surroundings is defined as Ca²⁺ signature (Reddy and Reddy, 2004). Ca²⁺ sensors can receive these specific calcium signals. The downstream target proteins receive the signals and cause a series of physiological and biochemical responses to improve plant stress tolerance.

Ca²⁺ sensor relays, calcineurin B-like proteins (CBLs) in plants, are named for the significant homology in amino acid sequence of calcieurin B (CNB) of animal and yeast (Kudla et al., 1999). CBL proteins contain four EF-hand domains binding to Ca²⁺. However, there are differences in EF-hand domains among different CBL proteins. CBL proteins have no enzymatic activity and need to interact with CBL-interacting protein kinase (CIPK) to transmit Ca²⁺ signals (Zhang et al., 2010). Under different stress conditions, the CBL-CIPK complex responds by calcium signal transduction. Under the condition of low potassium stress, CBL-CIPK complexes jointly activate potassium channel protein AKT1 on the cell membrane and form a potassium absorption regulation pathway in response to external low potassium environment. The studies on potassium absorption regulated by calcium signaling have been confirmed in Arabidopsis thaliana, Oryza sativa, Vitis vinifera, and Populus tremula (Cheong et al., 2007; Cuéllar et al., 2010; Zhang et al., 2010; Li et al., 2014).

Saccharum officinarum L. is the most important sugar crop in China. Potassium absorption can promote the development of sugarcane mechanical tissue, enhance stress tolerance, coordinate nitrogen absorption and promote sugar accumulation; therefore, potassium is indispensable in the growth and development of sugarcane. However, sugarcane is mainly distributed in the red soil region where the content of available potassium in soil is low. At the same time, potassium fertilizer use efficiency in sugarcane is only 30%, which is relatively low (Tan et al., 2011). Although traditional agriculture can enhance the yield and quality of sugarcane through high potash fertilizer application, it increases the agricultural production cost, and causes hardening of cultivated land and soil acidification, which hinders the sustainable development of sugarcane industry in China. Therefore, the study on potassium absorption and utilization pathways of sugarcane can not only increase the potassium absorption efficiency of sugarcane under the condition of low potassium, but also increase the utilization rate of potash fertilizer and potassium in soil. This study took ROC22 bred by Taiwan Sugar Research Institute as research materials to predict gene functions of the cloned sugarcane CBL family genes SsCBL1 and SsCBL6 by bioinformatics methods. Meanwhile, the expression of SsCBL1 and SsCBL6 were analyzed under low nitrogen, low phosphorus, low potassium, drought, salt and ABA stress, which could provide important references for the study of sugarcane stress resistance and potassium high-efficient molecular breeding.

1 Results and Analysis

1.1 Basic parameters analysis of sugarcane SsBL1 and SsCBL6 gene

Early in the study, using superior sugarcane variety ROC22 as the material, the seedlings were treated with low potassium, drought, salt stress and low temperature, and then sugarcane transcriptome sequencing was carried out. Two CBL genes of sugarcane were obtained by comparing the sequencing results with NCBI database, named SsCBL1 (GenBank: KC800 815.1) and SsCBL6 (GenBank: KC800 818.1), respectively. Using ORF-Finder, the online analysis software of NCBI database to find sequence ORF, the open reading frame length of SsCBL1 was 642 bp and encoded 213 amino acids. Using ExPASy online tool for analysis, the relative molecular weight (MW) of SsCBL1 protein was 24.485 kD, the molecular formula was C₁₁₀₄H₁₇₀₆N₂₈₀O₃₃₃S₈, and the theoretical isoelectric point (pI) was 4.75, which indicated that the protein was acidic. The amino acid sequences of SsCBL1 gene and CBL1 gene of other plants were compared. The results showed that SsCBL1 gene was highly homologous to Sorghum bicolor, Zea mays, Stipa purpurea, Triticum aestivum, Oryza sativa, etc (Figure 1). Using ORF-Finder, an online analysis software of NCBI database to find sequence ORF, the open reading frame length of SsCBL6 was 672 bp and encoded 223 amino acids. Using ExPASy online tool for analysis, the relative molecular weight (MW) of SsCBL6 protein was 25.675 kD, the molecular formula was C₁₁₅₆H₁₈₁₀N₂₉₈O₃₄₈S₇ and the theoretical isoelectric point (pI) was 4.82, which indicated that the protein was acidic. The amino acid sequences of SsCBL6 gene and CBL6 gene of other plants were compared. The results showed that SsCBL6 gene had high homology with Zea mays, Stipapurpurea, Triticu mdicoccoides, Triticum aestivum, Oryza sativa, etc (Figure 2).

1.2 The bioinformatics analysis of SsCBL1 and SsCBL6 encoding protein

TMHMM software was used to predict and analyze the transmembrane structure of SsCBL1 and SsCBL6 encoding protein sequence. The results showed that both of them had no transmembrane domain. The conserved domains of SsCBL1 and SsCBL6 protein sequences were predicted by CCD and SMART, online analysis tools of NCBI database. The results showed that SsCBL1 and SsCBL6 protein sequences contained four EF-hand (elongation factor hand) domains that could bind to Ca²⁺ (Figure 3; Figure 4), and the latter three were typical EF-hand domains, which provided the structural basis for Ca²⁺ binding.

The subcellular localization of SsCBL1 and SsCBL6 protein was carried out by Psort software. The results showed that the probability that SsCBL6 protein located in catalase was 63.5%, and that in cytoplasm was 45%. Therefore, it was suggested that SsCBL6 protein existed in catalase. The probability that SsCBL6 protein located in the mitochondrial matrix was 62.5%, and that in the mitochondrial intima was 32.5%. Therefore, it was suggested that the protein existed in the mitochondrial matrix.

1.3 Homology analysis and phylogenetic tree construction of SsCBL1 and SsCBL6

The amino acid sequences encoded by CBL1 gene of other plants obtained from the NCBI database were compared with SsCBL1 protein sequence and the phylogenetic tree was constructed for analysis (Figure 5). The results of cluster analysis showed that the amino acid sequences encoded by CBL1 in plants were highly conserved and homologous, and the homology of amino acid sequences was between 57% and 99%. Besides, the phylogenetic tree analysis showed that the CBL1 amino acid sequences of (gramineous crops) Sorghum bicolor, Zea mays, Oryza sativa, Triticum aestivum and Saccharum officinarum were closely related, and SsCBL1 had the closest relationship with CBL1 of Sorghum bicolor.

The amino acid sequences encoded by CBL6 gene of other plants obtained from the GenBank database of NCBI were aligned with SsCBL6 protein sequence and the phylogenetic tree was constructed for analysis (Figure 6). The results of cluster analysis showed that the amino acid sequences encoded by CBL6 in plants were highly homologous, and the homology of amino acid sequences was between 51% and 99%, and CBL6 amino acid sequences of (gramineous crops) Zea mays, Oryza sativa, Triticum aestivum, Hordeum vulgare, and Saccharum officinarum were closely related.

1.4 Effects of abiotic stresses on the expression of SsCBL1 and SsCBL6

qPCR primers were designed according to the ORF of SsCBL1 and SsCBL6, respectively. Using fluorescent quantitative PCR, the gene expression in root system from sugarcane ROC22 was analyzed under abiotic stresses for 8 h, 24 h, 48 h, and 96 h treatment. The results showed that the expression of SsCBL1 and SsCBL6 changed under low nitrogen, low phosphorus, low potassium, drought, salt and ABA stress. However, the gene expression under different stress conditions was not completely consistent, and there were some differences.

Under low nitrogen and low phosphorus stress, the expression of SsCBL1 gene was up-regulated for 8 h treatment and down-regulated for 24 h, 48 h and 96 h treatment. Under low nitrogen stress, the relative expression of SsCBL1 gene was down-regulated gradually along with the prolonging of stress time, and reached the lowest level at 96 h, which was about 0.308 time to comparison (Figure 7A). The relative expression of SsCBL1 gene was the lowest at 96 h under low phosphorus stress, which was 0.283 time to comparison (Figure 7B). Under low potassium stress, the relative expression of SsCBL1 gene decreased gradually along with the prolonging of stress time, and reached the lowest level at 96 h, which was about 0.315 time to comparison (Figure 7C). Under drought stress, the expression of SsCBL1 gene was up-regulated, and reached the highest level at 8 h, which was about 2.407 times to comparison. Under drought stress for 8 h to 48 h, the expression of the gene decreased gradually along with the prolonging of stress time, and reached the lowest level at 48 h, and then increased gradually (Figure 7D). Under salt stress for 8 h, 48 h and 96 h, the expression of SsCBL1 gene was up-regulated, and the up-regulation of expression was the most significant at 8 h, which was about 2.90 times to comparison (Figure 7E). Under ABA stress, the relative expression of SsCBL1 gene was down-regulated gradually along with the prolonging of stress time, but the change of expression levels was unremarkable (Figure 7F). Thus, it could be seen that the expression change of SsCBL1 gene was not significant under low nitrogen, low phosphorus, low potassium and ABA treatment, however, under drought and salt stress, the expression of SsCBL1 gene changed significantly.

Under low nitrogen, low phosphorus and low potassium stress, the relative expression of SsCBL6 gene was down-regulated gradually along with the prolonging of stress time, and reached the lowest level after 96 h stress treatment. Under low nitrogen and low phosphorus stress, the gene expression changed over time but was not significant (Figure 8A; Figure 8B). Under low potassium stress for 8 h and 24 h, the expression of SsCBL6 gene was up-regulated, and reached the highest level at 8 h, which was about 2.03 times to comparison (Figure 8C). Under drought stress for 8 h, the expression of SsCBL6 gene reached the highest level, which was about 2.069 times to comparison. Under drought stress for 24 h, the relative expression of the gene was down-regulated (Figure 8D). Under salt stress, the expression of SsCBL6 gene was up-regulated for 8 h and 48 h treatment, and was down-regulated for 24 h and 96 h treatment. The expression of SsCBL6 gene reached the highest level under salt stress for 8 h, which was about 3.538 times to comparison (Figure 8E). Under ABA stress, the expression of SsCBL6 gene was up-regulated slightly for 8 h and 48 h treatment while the expression was down-regulated slightly for 24 h and 96 h treatment (Figure 8F). In a word, the expression change of SsCBL6 gene was not significant under low nitrogen, low phosphorus stress and ABA treatment; however, under low potassium, drought and salt stress for 8 h, the expression of SsCBL6 gene was up-regulated significantly.

2 Discussion

CBLs is a kind of special Ca²⁺ signal receptor in plants. Its typical structural feature is containing four helix-loop-helix EF-hand structures which can bind to Ca²⁺ (Zhang et al., 2010). In this study, SsCBL1 and SsCBL6 genes were obtained from NCBI database, and structure, function, physicochemical properties of the proteins encoded by two genes were predicted and analyzed by bioinformatics method. SsCBL1 encoded 213 amino acids and SsCBL6 encoded 223 amino acids, all of which were acidic proteins. Structure analysis found that both of them had no transmembrane domain but both contained four EF-hand conserved domains, which provided a structural basis for Ca²⁺ binding. Phylogenetic tree analysis showed that CBL gene encoding proteins in plants had high homology, and SsCBL1 was closely related to Sorghum bicolor, Zea mays, Oryza sativa and Triticum aestivum; SsCBL6 had high amino acid sequence homology with Zea mays, Oryza sativa, Triticum aestivum, Hordeum vulgare and other gramineous plants. It indicated that SsCBL1 and SsCBL6 were closely related to graminaceous plants.

During the study of Arabidopsis CBL family genes, it was found that the expression level of the gene was the lowest under stress for 96 h. The relationship between low-nitrogen CBL and the information pathways induced by potassium starvation was given. Wu et al. have confirmed that Ca²⁺ sensors of CBL family, after binding to CIPK23, CBL1 and CBL9 could activate potassium channel protein AKT1 gene on cell membrane and form potassium absorption regulation pathway to regulate potassium absorption under low potassium environment in Arabidopsis thaliana (Wang and Wu, 2010). In this study, it was found that the expression of SsCBL1 was up-regulated under low potassium stress for 8 h and 24 h, which was about 1.23 times and 1.06 times to comparison. The results indicated that SsCBL1 gene might be involved in the potassium absorption in sugarcane, but had no obvious responses. The expression of SsCBL6 was also up-regulated under low potassium stress for 8 h and 24 h, which was about 2.03 times and 1.48 times to comparison. It was speculated that SsCBL6 might increase the tolerance of sugarcane to low potassium stress under low potassium stress. In a word, SsCBL1 and SsCBL6 could regulate the potassium absorption in sugarcane under low potassium stress.

In addition, in the course of studying CBL family genes of Arabidopsis thaliana and Oryza sativa, it was found that CBL genes could play an important role in regulation when plants were exposed to other stresses, thus enhancing the adversities resistance of plants. Arabidopsis AtCBL4 was discovered by genes associated with salt stress, which could participate in plant salt stress signal response (Liu and Zhu, 1998; Sanchez-Barrena et al., 2005). By studying the function of Arabidopsis without CBL1 gene, Cheong et al. (2003) found that CBL1 gene played an important role in enhancing drought and salt stress resistance of Arabidopsis thaliana. And the deletion of the gene would affect the expression of some transcription factors related to stress. Studies on CBL family genes of Oryza sativa showed that OsCBL6 and OsCBL8 would be induced to express under drought stress. ZmCBL6, ZmCBL8 and ZmCBL10 of Zea mays would also respond to drought stress in varying degrees (Li, 2012). In this study, the gene expression of SsCBL1 and SsCBL6 in sugarcane under low nitrogen, low phosphorus, drought, salt and ABA stress was analyzed. It was found that the expression levels of SsCBL1 and SsCBL6 genes changed under drought stress. The expression of SsCBL1 and SsCBL6 were 2.41 and 2.07 times higher than those of the control after 8 h stress treatment. It indicated that SsCBL1 and SsCBL6 could be induced to express under drought stress, which might enhance plant resistance to drought stress. The expression of SsCBL1 and SsCBL6 were 2.90 and 3.54 times higher than those of the control after 8 h salt stress treatment. It indicated that SsCBL1 and SsCBL6 could be induced by salt stress, which might improve the tolerance of sugarcane under high salt stress. Under low nitrogen, low phosphorus and ABA stress, the expression levels of SsCBL1 and SsCBL6 oscillated, but the changes were not significant. Thus, it could be seen that SsCBL1 and SsCBL6 might be induced and expressed by various stresses to enhance the tolerance of sugarcane to stress environment.

3 Materials and Methods

3.1 Experimental materials

The material used in the experiment was ROC22 from the nursery of Guangzhou Sugarcane Industry Research Institute. Sugarcane rhizomes should have similar growth. After cutting into single buds, they were soaked in carbendazim (10% concentration) for 30 min, then placed in quartz sand for cultivation. When the number of seedling leaves reached 3-4 pieces, robust seedlings with the same growth were selected and cultured in a plastic basin with a capacity of 10 L, and 4 seedlings were cultured in each basin. The seedlings were pre-cultured with improved nutrient solution Magnavaca for 30 d (Famoso et al., 2010), and in need of ventilation for 30 minutes every 2 hours. The experiment was carried out in the greenhouse of Guangdong Biological Engineering Institute (Guangzhou Sugarcane Industry Research Institute). The room temperature should be controlled at 30°C.

Different nutrient solutions were configured, and sugarcane seedlings were put into for experimental treatments: CK (normal culture medium), low nitrogen (nitrogen content was 0.1 mmol/L), low phosphorus (phosphorus content was 0.01 mmol/L), low potassium (potassium content was 0.1 mmol/L), drought (PEG-6000 content added was 150 g/L), salt stress (the concentration of NaCl was 1%), ABA stress (foliar spraying ABA concentration was 0.015 mmol/L). After 8 h treatment of sugarcane seedlings, two roots about 10 cm far from the root tip were cut from each plant, immediately wrapped in tinfoil and frozen in liquid nitrogen. Then, the sugarcane seedlings were treated according to the above methods for 24 h, 48 h and 96 h, respectively. All frozen samples were preserved at -80°C refrigerator for later use.

3.2 Cloning of SsCBL1 and SsCBL6 in sugarcane

The total mRNA in the root samples of sugarcane seedlings was extracted by Trizol (Invitrogen) method. The quality of mRNA was detected by electrophoresis. Then the cDNA (PrimeScript^TM RT reagent Kit with gDNA Eraser (TaKaRa)) was synthesized and placed at -20°C. The transcriptome sequencing results of ROC22 treated with stress during earlier period were analyzed, and the sequence with high similarity to CBL1 and CBL6 cloned from sugarcane GT28 was obtained. The specific primers were designed with biological software Primer Premier 5.0. The primer sequence was: SsCBL1 F: 5' GGGGTACCCCATGGGGTGCTTCCATTCCAC 3'; SsCBL1 R: 5' GCTCTAGAGCTCATGTGACGAGATCATCGACTTC 3'; SsCBL6 F: 5' CGAGCTCGATGGTGGACTTCGTTCG 3'; SsCBL6 R: 5' GCTCTAGAGCTCACGCATCCTCT 3'. cDNA synthesized by total mRNA of ROC22 root samples (low potassium stress treatment) was used as a template, and the enzyme (PrimerSTAR^® Max DNA Polymerase) produced by TaKaRa Company was chosen. PCR procedure was set as: 95°C for 5 min, 95°C for 15 s, 55°C for 45 s, 72°C for 2 min, with 35 cycles; 72°C for 10 min. PCR products were separated by using 2% agarose gel with 0.5 × TAE buffer solution at a voltage of 150 V for 30-min separation. TaKaRa Mini BEST Agarose Gel DNA Extraction Kit was used to recycle PCR products and connected to pEASY vector (Transgene), which was sequenced by Shanghai Sangon Company.

3.3 Parameter analysis of SsCBL1 and SsCBL6 sequences in sugarcane

The open reading frames of SsCBL1 and SsCBL6 were analyzed by online bioanalysis software ORF-Finder. The amino acid sequences of SsCBL1 and SsCBL6 were predicted by bio-software DNAMAN. The physicochemical properties of protein were predicted by online analysis software Protparam (http://www.expasy.ch/tools/protparam.html). SMART software (http://smart.embl-heidelberg.de/) and CDD online analysis tool (http://www.ncbi.nlm.nih.gov/cdd) were used to predict protein functional domain and conserved domain, respectively. Psort (http://psort.hgc.jp/form.html), an online bioanalysis tool, was used to predict subcellular localization. The online analysis tools, BLAST and DNAMAN were used to compare amino acid sequences with other species. ClustalX2.1 and MEGA6.0 were used to construct phylogenetic tree for analysis.

3.4 Expression analysis to abiotic stress of SsCBL1 and SsCBL6 in sugarcane

Based on the sequencing results (Sangon) of SsCBL1 and SsCBL6, quantitative real-time PCR (qPCR) primers were designed. The primer sequence: SsCBL1-RTF: 5' ATTCCACGGCGAAGC 3'; SsCBL1-RTR: 5' CAATGACACCCCTTTTCTTGACATC 3'. SsCBL6-RTF: 5' GCTCGCCTCTGCCCTC 3'; SsCBL6-RTR: 5' ATTCAAGCCATCATCAACCACAGC 3'.

The reaction system of fluorescence quantitative PCR: 1 μL cDNA template, 0.5 μL upstream primer and 0.5 μL downstream primer with the concentration of 10 μmol/L, 10 μL 2 × SYBR Mix solution (TOYOBO), 8 μL ultrapure water. β-Tublin was selected as a reference gene. The reaction procedure was as follows: 95°C for 5 min with a cycle; 95°C for 10 s, annealing temperature at 60°C for 45 s with 40 cycles. The internal reference gene was GAPDH, and the gene expression was analyzed by 2^-△△Ct method.

Authors’ contributions

LQP was the executor of the experimental design and research of this study, finishing data analysis and first draft writing; ZQY, WJY and HF participated in experimental design and test results analysis; LQW and QYW were designers and principals of the project, guiding experimental design, data analysis, paper writing and modification. All authors read and approved the final manuscript.

Acknowledgements

The study was funded by the National Sugarcane Industrial Technology System (CARS-20-1-4), Guangdong Academy of Sciences Special Fund Project for Research Platform Environment and Capacity Building (2016GDASPT-0306) and Guangdong Provincial Technology Plan (2017A030303048; 2014A040401033; 2014B070705002; 2014B090907006; 2015A020209026; 2016A030313415).

References

Cheong Y.H., Kim K.N., Pandey G.K., Gupta R., Grant J.J., and Luan S., 2003, CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis, Plant Cell, 15(8): 18331-18184

https://doi.org/10.1105/tpc.012393

PMCid:PMC167173

Cheong Y.H., Pandey G.K., Grant J.J., Batistic O., Li L., Kim B.G., Lee S.C., Kudla J., and Luan S., 2007, Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis, The Plant Journal, 52(2): 223-239

https://doi.org/10.1111/j.1365-313X.2007.03236.x

PMid:17922773

Cuéllar T., Pascaud F., Verdeil J.L., Torregrosa L., Adam-Blondon A.F., Thibaud J.B., Sentenac H., and Gaillard I., 2010, A grapevine Shaker inward K⁺ channel activated by the calcineurin B-like calcium sensor 1-protein kinase CIPK23 network is expressed in grape berries under drought stress conditions, The Plant Journal, 61(1): 58-69

https://doi.org/10.1111/j.1365-313X.2009.04029.x

PMid:19781051

Dong L.H., Shi S.J., Nuruzzaman Manik S.M., Su Y.L., Liu C.K., Feng X.G., Hu X.M., Wang Q., and Liu H.B., 2015, Research advances in CBLs gene family in plants, HenongxueBao (Journal of Nuclear Agricultural Sciences), 29(5): 892-898

Famoso A.N., Clark R.T., Shaff J.E., Craft E., McCouch S.R., and Kochian L.V., 2010, Development of a novel aluminum tolerance phenotyping platform used for comparisons of cereal aluminum tolerance and investigations into rice aluminum tolerance mechanisms, Plant Physiol., 153(4): 1678-1691

https://doi.org/10.1104/pp.110.156794

PMid:20538888 PMCid:PMC2923895

Kudla J., Xu Q., Harter K., Gruissem W., and Luan S., 1999, Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals, Proc. Natl. Acad. Sci. USA, 96(8): 4718-4723

https://doi.org/10.1073/pnas.96.8.4718

PMid:10200328

Li J., Long Y., Qi G.N., Xu Z.J., Wu W.H., and Wang Y., 2014, The Os-AKT1 channel is critical for K⁺ uptake in rice roots and is modulated by the rice CBL1-CIPK23 complex, The Plant Cell Online, 26(8): 3387-3402

https://doi.org/10.1105/tpc.114.123455

PMid:25096783 PMCid:PMC4176441

Li J.Y., 2012, Cloning of ZMCBL10 and functional analyses of ZmCBL6 and ZmCBL8 from maize (Zea mays L.), Thesis for M.S., Inner Mongolia Agricultural University, Supervisor: Wang M.Y., pp.27-28

Liu J., and Zhu J.K., 1998, A calcium sensor homolog required for plant salt tolerance, Science, 280(5371): 1943-1945

https://doi.org/10.1126/science.280.5371.1943

PMid:9632394

Reddy V.S., and Reddy A.S.N., 2004, Proteomics of calcium-signaling components in plants, Phytochemistry, 65(12): 1745-1776

https://doi.org/10.1016/j.phytochem.2004.04.033

PMid:15276435

Sanchez-Barrena M.J., Martinez-Ripoll M., Zhu J.K., and Albert A., 2005, The structure of the Arabidopsis thaliana SOS3: molecular mechanism of sensing calcium for salt stress response, J. Mol. Biol., 345(5): 1253-1264

https://doi.org/10.1016/j.jmb.2004.11.025

PMid:15644219

Tan H.W., Zhou L.Q., Xie L.R., and Huang M.F., 2011, Potassium uptake and its utilization in sugarcane under the different fertilization levels, Nanfang Nongye Xuebao (Journal of Southern Agriculture), 42(3): 295-298

Wang Y., and Wu W.H., 2010, Plant sensing and signaling in response to K⁺-deficiency[J], Molecular plant, 3(2): 280-287

https://doi.org/10.1093/mp/ssq006

PMid:20339156

Zhang C.W., Wang T.Y., and Li Y., 2010, Molecular mechanisms of transducting specific calcium signal in CBL-CIPK pathway in plant, Zhiwu Yichuan Ziyuan Xuebao (Journal of Plant Genetic Resources), 11(4): 462-468

Zhang H., Yin W., and Xia X., 2010, Shaker-like potassium channels in Populus, regulated by the CBL-CIPK signal transduction pathway, increase tolerance to low-K⁺ stress, Plant Cell Reports, 29(9): 1007-1012

https://doi.org/10.1007/s00299-010-0886-9

PMid:20582419