MADS-box gene family is a group of transcription factors that regulate plant growth and development, especially in flower meristem development, control flowering time and flower organ development (Yao et al., 2018). The N-terminal of the proteins encoded by them all contain MADS-box conserved domain composed of 50~60 amino acids (Liu et al., 2010).

Becker and Theissen (2003) proved that MADS-box gene formed two lineages of Type I and Type II in evolution. MADS-box genes of Type I mainly include SRF-like/ARG80 genes in animals and fungi and MADS-box genes in plants without K domain. Type II MADS-box genes were dominated by MEF2-like genes from animals and fungi and MIKC type genes from plants (Kaufmann et al., 2005). The MADS-box gene in higher plants consists of four unique domains: The MADS (M) box, the Intervening (I) region, the Keratin (K) box and the C-terminal (C) terminal (Ma et al., 1991). Among them, region I is a non-conserved region composed of 31-35 amino acid residues, which plays an auxiliary role in the combination of dimer and DNA to form a complex. K region is a unique sequence of MADS-box transcription factors in plants, with about 70 amino acid residues (Zhang et al., 2013). C-terminal is a non-conserved region composed of about 30 amino acids, located downstream of K region, which can activate the transcription process (Wang et al., 2015).

AGAMOUS (AG) is a gene in MADS-box gene family, which is one of the earliest genes found to be closely related to flower development in plants (Gong et al., 2009). Since 1990, Ma et al. (1991) cloned the flower homologous gene AG in Arabidopsis thaliana for the first time, AG homologous genes in many plants have been cloned successively. AG homologous genes can be identified as a characteristic structure of Class C genes in the two conserved regions of AG I and AG II at the end of C (Xu and Wang, 2011). Although there have been many studies on AG gene, the study of its upstream and downstream genes and the molecular mechanism of action is not very comprehensive.

In recent years, the molecular biology research on the development mechanism of higher plants has been gradually developed, and the flowering process, as the most significant transformation stage of plants, has always been the focus of research. Since Ginkgo biloba's infancy lasts for 20 years, the flowering mechanism of Ginkgo biloba is the focus of research. The flowering pathways of higher plants have made great progress since the 1980s, and at least five flowering regulatory pathways have been proposed in Arabidopsis. There are photoperiodic promotion pathway, vernalization promotion pathway and autonomous promotion approach, GA promotion pathway and flowering repression pathway (Zhang, 2002).

CO gene is an important flowering time regulation gene in the photoperiodic pathway of plants. Studies have shown that regulating the expression of FT can regulate flowering of plants (Jager et al., 2003). GbCO gene was first cloned from Ginkgo biloba in 2010, encoding a protein composed of 373 amino acids. It contains two B-box zinc finger molds (Zhang, 2002). As a ubiquitous transcription factor, FLC gene in MADS-box gene family plays an important role in the vernalization process of plants (Hong and Cao, 2002). The expression level of MADS-box protein is closely related to the flowering time of plants. At the same time, FLC gene is also regulated by related genes in the autonomic flowering pathway, and acts as rheostat in both flowering pathways (Michaels et al., 1999). EMF gene, the main suppressor of flowering repression pathway, negatively regulates with AP1 and AG to inhibit flowering, while CO and GI negatively regulate EMF gene (Yang et al., 1995). In addition, AG gene and APETALA2 (AP2) gene inhibit APETSLA1 (AP1) gene expression in the third and fourth round of flower organs (Jack et al., 1997). Several flowering regulation pathways are interrelated and jointly regulate the flowering of higher plants.

Ginkgo biloba L. is the oldest relict plant in the surviving gymnosperms and is recognized as a "living fossil" (Wen et al., 2010). Ginkgo biloba in China accounts for more than 90% of the total resources in the world, and is a multi-purpose and treasured species unique to China, with unique morphological characteristics, systematic evolution and taxonomic status. Ginkgo is loved by people for its unique ecological value, economic value, medicinal value, ornamental value and scientific research value. In the 1960s, the important medicinal value of Ginkgo biloba for cardiovascular and cerebrovascular diseases was discovered. In 1965, German doctor Willmar Schwabe introduced Ginkgo biloba extract (EGB761) into clinical medicine (van Beek, 2000), which subsequently led to the research and development of the medicinal value of Ginkgo biloba in academic circles (Cao et al., 2007). The flowering of Ginkgo biloba seedlings after 15~20 years seriously affected the selection and breeding of Ginkgo biloba superior varieties. Therefore, this study intends to further study the role of AG MADS-Box transcription factors in the regulation of ginkgo flowering through sequence analysis and expression analysis of GBM5 gene, so as to analyze the molecular regulation mechanism of ginkgo flowering, to promote the flowering of Ginkgo biloba from the molecular level and accelerate the breeding of superior varieties.

1 Results and Analysis

1.1 Cloning of GBM5 gene

Using cDNA of Ginkgo biloba stem as template and specific primers Gb16301-F and Gb16301-R as primers, DNA fragment with length of 732 bp was obtained by PCR amplification (Figure 1). Sequence comparison was conducted on NCBI. It was found that it had a high ratio of comparison with AGAMOUS-like gene GBM5 (Registration number: AY114304.1) in MADS-box family of Ginkgo biloba, so the cloned sequence was temporarily named GBM5.

Figure 1 PCR product of GBM5 Note: M: MD116 DNA Maker; 1: Target gene

1.2 Sequence analysis and tertiary structure prediction of GBM5 protein

Basic physical and chemical parameters such as GBM5 isoelectric point and gene protein size of Ginkgo biloba were analyzed by ProtParam tool in ExPASy program (Figure 2). The predicted results showed that the isoelectric point (pI) of GBM5 protein was 8.55, the molecular weight was about 27 kD, the molecular formula was C₁₁₈₈H₁₉₂₃N₃₅₇O₃₆₆S₁₂, and the instability coefficient was 56.48, suggesting that GBM5 protein was an unstable protein. The mean value of overall hydrophilicity is -0.519, which belongs to hydrophilic protein. The secondary and tertiary structures of GBM5 protein were predicted online (Figure 3), and the proportions of α-helix(H), β-sheet(E), β-turn (T) and random coil (C) were 70.78%, 7.82%, 3.70% and 17.70%, respectively.

Figure 2 Deduced amino acid sequence of GBM5 and overall length cDNA sequence Note: The red boxes represent the starter and terminator

Figure 3 Tertiary structure prediction of GBM5 protein

1.3 Phylogenetic analysis of GBM5 gene

In order to study the evolutionary relationship between GBM5 gene of Ginkgo biloba and other plant genes, MEGA 7.0 software was used for cluster analysis of GBM5 gene of Ginkgo biloba and AG gene of Arabidopsis thaliana, Camphor oil-free and Cycad (Figure 4). Cluster analysis showed that the GBM5 gene of Ginkgo biloba was most closely related to Cycas Revoluta AG gene, followed by Picea mariana AG gene in Pinaceae, and Amborella trichopoda AG gene in relict plants. The AG gene of Prunus mume, Arabidopsis thaliana, and Camellia japonica has longer evolutionary relationship, and the AG gene of Oryza sativa has the longest evolutionary relationship. The amino acid sequence encoded by GBM5 was compared with protein in NCBI (Figure 5) and the result showed that GBM5 belonged to AG gene. The results showed that AG gene plays an important role in regulating flowering time and determining floral organ development. It is speculated that GBM5 gene is related to flowering time and floral organ development.

Figure 4 Analysis diagram of the phylogenetic tree of GBM5 and AG gene in other species Note: At: Arabidopsis thaliana; Amt: Camphor oil-free; Ce: Cycad Cj: Camellia; Os Rice; Pm: Black spruce; Prm: Plum

Figure 5 Alignment of GBM5 protein with other AG proteins

1.4 The relative expression levels of GBM5 gene in different tissues of Ginkgo biloba

Studies have shown that MADS-box family genes play an important role in the development of reproductive organs, so the expression level of GBM5 gene in Ginkgo biloba leaves, stem tips, female flowers and male flowers was detected by qPCR. The results showed that GBM5 was expressed in female flowers, male flowers and stem tips of reproductive organs, and the highest expression level was found in female flowers, followed by male flowers, stem tips and leaves, and the lowest expression level was found in leaves (Figure 6). There was extremely significant difference in the expression level among different tissues (<0.05). GBM5 gene is highly expressed in female and male flowers of Ginkgo biloba, which is the same as AG gene expression pattern of tea tree, plum and other plants 21 (Hou, 2009), which is speculated to be the possible reason for the high expression level of GBM5 gene in reproductive organs.

Figure 6 Expression levels of GBM5 gene in different tissues Note: Different lowercase letters above each column indicate significant differences at the 0.05 level

1.5 The relative expression levels of GBM5 gene in Ginkgo biloba at different periods

The results showed that the expression level of GBM5 gene in leaves and stem tip showed a decreasing trend from the undifferentiated stage of flower buds in April, the beginning stage of flower buds differentiation in May to the peak stage of flower buds differentiation in September. The expression level of GBM5 gene was higher at the undifferentiated stage of flower buds. The results showed that the expression level was highest in April, followed by May, and lowest in September in leaves (Figure 7A); the expression level was highest in April, followed by May, and lowest in September in stem ends (Figure 7B). The expression levels of samples in different periods were significantly different (P<0.05).

Figure 7 Expression levels in leaves and stems of GBM5 genes at different time Note: A: Ginkgo GBM5 gene expression level in leaves; B: Ginkgo GBM5 gene expression level in the stem end; Horizontal axis represents different periods, April: Flower bud undifferentiated period; May: Flower bud differentiation stage; September: Flower bud differentiation period; Different lowercase letters above each column indicate significant differences at the 0.05 level

2 Discussion

In this study, a specific primer was designed according to the measured ginkgo transcriptome data, and 732 bp GBM5 gene was cloned from Ginkgo biloba by RT-PCR technology. Protein sequence analysis showed that the protein encoded by GBM5 gene contained the MADS conservative domain and K region, with typical plant MADS-box gene structure. Phylogenetic analysis showed that GBM5 gene was highly homologous with AG gene, so it was speculated that GBM5 gene belonged to the AG gene in MADS-box gene family.

Members of MADS-box gene family play crucial roles in the reproductive development of higher plants. At present, the AG genes in MADS-box gene have been well studied in terms of structure, function, homologous gene cloning and gene evolution (Gao et al., 2008). Sieburth and Meyerowitz (1995) showed that the AG allele can deal with the role of Arabidopsis genes that determine the specificity of round 3 and round 4 during flower determination, and believed that the AG gene requires a corresponding critical value in order to perform the desired function. However, due to the diversity of MADS-box gene expression patterns and great differences in function, the mechanism of the interaction of AG gene on upstream and downstream genes to jointly regulate flower development has not been determined. Xu and Wang (2011) found that AG homologous gene is related to the development of sporophyll in gymnosperms, and the main role of AG in the reproductive organs of gymnosperms is to determine the differentiation and development of sporophyll.

In this study, cluster analysis of GBM5 gene and AG-like genes showed that GBM5 gene of Ginkgo biloba and Cycas AG had the closest genetic relationship, that is, the gene function was more similar. It was found that the gene expression level in the main reproductive organs of Ginkgo biloba was much higher than that in the vegetative organs. The gene expression level in female and male flowers was the highest, followed by the stem end, and the leaf was the least. The content of GBM5 in the stem and leaf of plants decreased significantly with the degree of differentiation, and the decrease degree of GBM5 in the stem was greater than that in the leaf. The results showed that GBM5 gene was highly expressed in female flowers and male flowers of Ginkgo biloba, which was the same as AG gene expression pattern of tea tree, plum and other plants. Therefore, GBM5 gene expression was basically consistent with MADS-box gene expression pattern, and it was inferred that GBM5 gene function was similar to MADS-box gene function. That is, it plays a certain role in regulating the growth and development of Ginkgo biloba. At present, LFY, AG, FT and AP1 are the main flowering regulation genes in woody plants. There are few reports on the use of transgenic technology to shorten the cloning and expression of woody plants.

In the future, more undiscovered new AG genes will be cloned, and more mutants will be identified, so as to realize in-depth research and progress in the related gene function field. Through cloning, sequence analysis, bioinformatics analysis and phylogenetic analysis of GBM5 gene obtained by transcriptome sequencing, this study provides a theoretical basis for further research on key flowering genes of Ginkgo biloba and analysis of flowering regulation mechanism.

3 Materials and Methods

3.1 Experimental material

The stem end of Ginkgo biloba was obtained from adult ginkgo trees in the Botanical Garden of Central South University of Forestry and Technology. The stem end of Ginkgo biloba was frozen with liquid nitrogen and stored in a refrigerator at -80℃. Then RNA extraction and sequencing were performed. EX Taq Polymerase, dNTP Mixture, Buffer, 5×PrimeScript RT Master Mix (Perfect real time) Reverse Transcription Kit (TaKaRa), MD116 DNA Marker (Beijing TransGen Biotech Co., Ltd.), E.Z.N.A. TM Plant RNA Kit (Omega Bio-Tek), High purity Plasmid Microextraction Kit (ComWin Biotech Co., Ltd.), SanPrep Column DNA Gel Recovery Kit (Sangon (Shanghai) Biotech Co., Ltd.), other conventional reagents used in domestic analytical pure or imported packaging.

3.2 Total RNA extraction and synthesis of the first strand of cDNA

E.Z.N.A. TM Plant RNA kit was selected for rapid extraction of total RNA from Ginkgo biloba stem. The first strand of cDNA was reversely transcribed according to the procedure and introduction of the 5×PrimeScript RT Master Mix kit: total RNA 8 μL, Oligo (dT) 18 primer 1 μL, the total volume of rnASE sterile water to reagent 12 μL. Incubate at 65℃ for 5 min and cool down on ice. Then 5×Reaction buffer 4 μL, Ribolock RNase Inhibitor (20 U/μL) 1 μL, 10 mmol/L dNTP Mix 2 μL and RevertAid M-mulv RT were added in a certain order (200 U/μL) 1 μL, 20 μL reverse transcription system, incubated at 42℃ for 60 min, water bath at 70℃ for 5 min, and the reaction was terminated. The cDNA concentration was detected by UV spectrophotometry. The obtained samples were stored in a refrigerator at -20℃ for later use.

3.3 PCR amplification and recovery, cloning and determination of the product

According to the different stages of plant stem end database related gene sequence length, by NCBI, clear the corresponding gene sequences, through Primer5.0 create the required specific primers, amplification primer F: TCCCCCGGGATGGGCCGTGGGAAGATT; R: CGCGGATCCTCATCCAAGTTGAAGGGCC. 20 μL PCR was prepared under the following conditions: DNA 0.5 μL (about 100 ng/μL), primer on both sides corresponding to 0.5 μL, dNTP Mixture 2 μL, MgCl₂ (25 mmol/L) 1.5 μL, 10×PCR Buffer 2 μL, Ex Taq 0.2 μL, dH₂O 12.8 μL. PCR reaction conditions were as follows: 95℃ for 3 min, 95℃ for 30 s, 60℃ for 30 s, 72℃ for 60 s, 40 cycles; Extension at 72℃ for 5 min and preservation at 4℃.

SanPrep Column DNA gel recovery kit was used to recover the target DNA fragment of PCR amplification product detected by agarose gel electrophoresis. The recovered part remained connected to the vector and was transformed into E. coli DH5α for blue and white spot screening. PCR detection was conducted after culture of the bacteria liquid. The positive bacteria solution was selected and transported to Shanghai Beauchamp to achieve the expected sequencing effect.

3.4 Bioinformatics analysis of GBM5 gene

The open reading frame (ORF) corresponding to GBM5 gene sequence was obtained by NCBI online platform. DNAMAN software was used to predict the amino acid sequence encoded by the target gene sequence. The BLAST program on NCBI was used to analyze the homology of protein and DNA, and the Conserved Domains program on NCBI was used to predict the conserved domains. MEGA7.0 software was used for clustering analysis of GBM5 gene.

3.5 Fluorescence quantitative PCR (qRT-PCR)

The expression level of GBM5 gene in Ginkgo biloba leaves and stem tips of short branches was detected by cDNA template using QRT-PCR method. GAPDH was used as an internal reference gene. GBM5 specific primers: upstream primer: 5 'AGAGGATTGAGAACAATAC 3'. Downstream primer: 5 'GCACGGATAATTCATACG 3'. Qrt-pcr was performed with SuperReal PreMix Plus (SYBR Green) of Tiangen Company. 20 μL reaction system: 2×SuperReal PreMix Plus (with SYBR Green I) 10 μL, upstream primer (10 μmol/L) and downstream primer (10 μmol/L) 0.8 μL, ROX Reference Dye II 0.4 μL, CDNA4.0 μL and dH2O 4.0 μL. Three biological replicates were set for each tissue sample. The reaction conditions were as follows: 95℃ 15 min, 95℃ 10 s, 60℃ 30 s, 40 cycles. At the end of amplification, the temperature gradually increased from 60℃ to 95℃ at the rate of 0.5℃/10 s, and the sample was collected by fluorescence and analyzed by 2^-∆∆Ct method.

Authors’ contributions

LYL and DJJ were the experimental designers and executors of this experiment. YTT completed data analysis; LYL completed the first draft of her thesis; WYQ is the architect and principal of the project, guiding data analysis, paper writing and revision. LM, YG, FZ, ZP, WGB and YWW all gave a lot of help in this research process. All authors read and approved the final manuscript.

Acknowledgement

This study was supported by the National Key Research and Development Program of China (2017YFD0600701) and the National Natural Science Foundation of China (31570682).

Reference

Becker A., and Theissen G., 2003, The major clades of MADS-box genes and their role in the development and evolution of flowering plants, Mol. Phylogenet Evol., 29(3): 464-489

https://doi.org/10.1016/S1055-7903(03)00207-0

Cao F.L., eds., 2007, China ginkgo annals, China forestry press, Beijing, China, pp.128-132

Gao Z.H., Zhang Y.M., Wang S., and Zhang Z., 2008, Research progress in floral organ identity gene AGAMOUS, Xibei Zhiwu Xuebao (Acta Botanica Boreali-Occidentalia Sinica), (3): 638-644

Gong X.F., Hu J.Q., Liu J.Y., and Wang L.L., 2009, Expression and regulation of AGAMOUS homologous, Hnagzhou Shifandaxue Xuebao (Journal of Hangzhou Normal University Natural Science Edition), 8(3): 218-223

Hong W., and Cao J.S., 2002, The function of FLC in vernalization process, Zhiwuxue Tongbao (Chinese Bulletin of Botany), 19(4): 406-411

Hou J.H., 2009, Cloning and expression analysis of plum AGAMOUS (AG) gene, Thesis for M.S., Nanjing Agricultural University, Supervisor: Gao Z.H., pp.21-24

Jack T., Sieburth L., and Meyerowitz E., 1997, Argeted misexpression of AGAMOUS in whorl 2 of Arabidopsis flowers, The Plant Journal, 11(4): 825-839

https://doi.org/10.1046/j.1365-313X.1997.11040825.x

Jager M., Hassanin A., Manuel M., Le Guyader H., and Affiliations J.D., 2003, MADS-box genes in Ginkgo biloba and the evolution of the AGAMOUS family, Mol. Biol. Evol., 20(5): 842-854

https://doi.org/10.1093/molbev/msg089

Kaufmann K., Melzer R., and Theißen G., 2005, MIKC-type MADS-domain proteins: structural modularity, protein interactions and network evolution in land plants, Gene, 347(2): 183-198

https://doi.org/10.1016/j.gene.2004.12.014

Liu J.H., Xu B.Y., Zhang J., and Jin Z.Q., The interaction of MADS-box transcription factors and manipulating fruit development and ripening, Yichuan (Genetic), 32(9): 893-902

Ma H., Yanofsky M.F., and Meyerowitz E.M., 1991, AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes, Genes & Development, 5(3): 484-495

https://doi.org/10.1101/gad.5.3.484

Michaels S.D., and Amasino R.M., 1999, FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering, The Plant Cell, 11(5): 949-956.

https://doi.org/10.1105/tpc.11.5.949

Sieburth L.E., and Meyerowitz R.E. M., 1995, Genetic separation of third and fourth whorl functions of AGAMOUS, The Plant Cell, 7(8): 12491258

https://doi.org/10.2307/3870099

van Beek T.A., Chemical analysis of Ginkgo biloba leaves and extracts, J. Chromatography A., 967(1): 21-55

https://doi.org/10.1016/S0021-9673(02)00172-3

Wang C.Z., Yu X.M., Dong Q.L., Zhang A.N., Liu W., Dong F., and Wang S.Z., 2015, Bioinformatic and expression analysis on the known MADS-box transcription factors at different development stages of flower in peach, Henongxue Bao (Journal of Nuclear Agriculture), 29(5): 849-858

Wen Y.Y., Wang Y.G., Yin M.Q., Zhao J., and Wang J.Q., 2010, Sex identification and regulation of Ginkgo plantlets in vitro cultured, Henongxue Bao (Journal of Nuclear Agricultural Sciences), 24(1): 31-35

Xu L., and Wang L.L., 2011, Advances in research on the regulation mechanism of plant AGAMOUS gene, Zhejiang Nongye Kexue (Zhejiang Agricultural Science), (6): 1417-1422

Yang C.H., Chen L.J., and Sung Z.R., 1995, Genetic regulation of shoot development in Arabidopsis: role of the EMF genes, Developmental Biology, 169(2): 421-435.

https://doi.org/10.1006/dbio.1995.1158

Yao Q.Y., Li F.F., Zhang C.L., and Zhou S.E., 2018, Research progress in MADS-box transcription factors involved in regulation of abiotic stress of plants, Jiangxi Nongye Xuebao (Acta Agriculturae Jiangxi) 30(5): 73-79

Zhang J.Y., 2002., Studies on cloning of LEAFY homologuesand identifying its fundamental in Ginkgo biloba L., Dissertation for Ph.D., College of Agriculture and Biotechnology, Zhejiang University, Supervisor: Chen L.G., pp.7-11

Zhang Y.S., Qin X.M., Yan J.P., Zhang K.L., and Yang E., 2013, Bioinformatics analysis of the MADS-box gene family in banana, Zhiwu Shengli Xuebao (Plant Physiology Journal), 49(10): 1030-1040