Genetic Transformation of Brassica napus with MSI-99m Gene Increases Resistance in Transgenic Plants to Sclerotinia sclerotiorum  

Xuelian Sang , Dengwei Jue , Liu Yang , Xiao Bai , Min Chen , Qing Yang
College of Life Sciences, Nanjing Agricultural University, Nanjing, 210095, P. R. China
Author    Correspondence author
Molecular Plant Breeding, 2013, Vol. 4, No. 30   doi: 10.5376/mpb.2013.04.0030
Received: 29 Jul., 2013    Accepted: 26 Sep., 2013    Published: 27 Sep., 2013
© 2013 BioPublisher Publishing Platform
This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article:

Sang et al., Genetic Transformation of Brassica napus with MSI-99m Gene Increases Resistance in Transgenic Plants to Sclerotinia sclerotiorum, Molecular Plant Breeding, Vol.4, No.30 247-253 (doi: 10.5376/mpb.2013.04.0030)

Abstract

Magainins are a class of antimicrobial peptides isolated from skin secretions of the African clawed frog Xenopus laevis. MSI-99 is a synthesized magainin II analogue with inhibitory effects to a wide spectrum of microbial organisms, including bacteria, fungus and viruses. Sclerotinia sclerotiorum is one of the most destructive pathogens in rape (Brassica napus), causing devastating yield losses. To evaluate its resistance to rape Sclerotina rot, we transferred the MSI-99m gene (modified MSI-99) into Chinese rape variety Zhongyou 821 using Agrobacterium-mediated method. Nine transformed lines carrying a MSI-99m expression vector were detected by polymerase chain reaction (PCR), among which seven lines expressed MSI-99m gene according to qRT–PCR analysis. Disease resistance analysis consistently showed that the high level expression of MSI-99m increased resistance to S. sclerotiorum in transgenic rape lines. This result demonstrated that MSI-99m gene may be applied as a resistant gene resource in rape for the improvement of rape varieties.

 

Keywords
Brassica napus; MSI-99m; Transformation; Sclerotinia sclerotiorum; Disease resistance

Rape (Brassica napus) is one of the world’s major oilseed crops and the most important source of edible oil in China (Momoh et al., 2002). But rape is also susceptible to a series of fungal diseases, such as Sclerotinia rot, downy mildew, and white rust. Of the fungal diseases, Sclerotinia rotis the most destructive disease which could cause the rotting of leaves, stemsand pods, resulting in a tremendous loss in seed yield and quality in differentregions all over the world(Dong et al., 2008; Guo and Stotz, 2007). In China this disease can cause a 15% yield loss nationally every year. Biotechnology breeding is a valuable alternative way for solving the problem above and has been successfully applied in plant resistance improvement.

In recent years, some successes in genetic transformation for introducing resistant genes into rape have been reported. The expression of antimicrobial peptide gene PmAMP1 in rape conferred greater protection against Alternaria brassicae, Leptosphaeria maculans and Sclerotinia sclerotiorum (Verma et al., 2012). Meanwhile, constitutively expressing OXO in transgenic rape displayed considerably increased OXO activity and enhanced resistance to S. sclerotiorum (Dong et al., 2008). However, in production, the appearance of new races of pathogens caused by variation often results in loss of host resistance, which could be made up through using genes with a wide spectrum of resistance.
Antimicrobial peptides (AMP) are small cationic, pore-forming peptides with inhibitory activities against a spectrum of pathogens, which usually are obtained from animals (Rao, 1995) or even plants(Broekaert et al., 1997). Magainin II is one of the earliest reported antimicrobial peptides isolated from the skin secretions of the African clawed frog Xenopus laevis (Zasloff, 1988), which has been studied extensively because of its strong inhibitory effects on a broad spectrum of plant pathogens (Aboudy et al., 1994) and its potential application in disease resistance breeding (O’Callaghan et al., 2008).
MSI-99, a magainin II analogue, is synthesized by making several modifications in magainin II (Everett, 1994; Maloy and Kari, 2004). Thegene has been transferred into different plants and its expression can enhance resistance against Sclerotinia sclerotiorum, Alternaria alternata and Botrytis cinerea, Pseudomonas syringae pv tabaci, Aspergillus flavus, Fusarium moniliforme, Verticillium dahliae, and Colletotrichum destructivum in transgenic tobacco(Chakrabarti et al., 2003; DeGray et al., 2001), Fusarium oxysporum f. sp. cubense and Mycosphaerella musicola in transgenic banana (Atkinson et al., 2003), and Pseudomonas syringae pv. tomato in transgenic tomato (Conlon and Kim, 2000).
MSI-99m, a synthesized MSI-99 gene adapted for expression in potato(Huada), was introduced in potato and transgenic plants exhibited increased resistance to Phytophthora infestans and Ralstonia solanacearum (Hong et al., 2012). In this paper, we reported the results in genetic transformation of rape with the MSI-99m gene and the assessment of transgenic plants for their resistance to S. sclerotiorum.
1 Results
1.1 Regeneration of transgenic rapeplants
The hypocotyl explants infected were co-cultured with A. tumefaciens GV3101 on RM1 medium for 2 days (Figure 1 A). Then they were transferred to the RM2 medium for the induction of callus. Callus was visible on the cut surface after 2 weeks of culture (Figure 1 B). Shoots appeared from the explants after one month on shoot induction medium (RM3). Some of them could grow to normal green plantlets, whereas the majority bleached in the presence of Kan (Figure 1 C). When the green plantlets grew up to 3 cm length they were inoculated on RM4 medium with 15 mg/L Kan for antibiotic resistance selection (Figure 1 D~Figure 1 E. The rooting plantlets were finally transplanted in pots and placed in the greenhouse (Figure 1 F). In total, 25 independent Kan-resistant putative transformants were regenerated, 9 of which were confirmed to be PCR-positive (Figure 2).


Figure 1 Regeneration of MSI-99m transformedrape plants


Figure 2 PCR detection of 9 MSI-99m transgenic rape lines

1.2 Expression of MSI-99m Gene in Transgenic Plants
Expression of MSI-99m gene in the 7 transgenic lines was analyzed using quantitative RT-PCR. MSI-99m was expressed in all the transgenic lines but the levels of transcripts among the transgenic lines were very different (line M14 is 9 times of line M10). No expression of MSI-99m was observed in the wild-type control (Figure 3).


Figure 3 qRT-PCR analysis of MSI-99m expression in transgenic lines and wild-type plants

1.3 Evaluation of transgenic plant resistance to Sclerotinia sclerotiorum
To evaluate resistance of the transgenic lines to S. sclerotiorum, detached leavestest, young planttest and adult plant test were applied in this experiment.
1.3.1 Detached leaf assay
Detached leaf test was carried out with 7 transgenic lines and the wild-type control. After 4 days of co-culture with S. sclerotiorum, wild-type leaves presented a full scale necrotic area and substantial fungus mycelium grown around the surface of leaves. While transgenic lines except line M10 showed some light watery spots and still kept a healthy dark green coloration (Figure 4 A). The disease index of the transgenic lines and the wild type are shown in Figure 4B and they were lower in all transgenic linesthan in the wild-type controls except line M10, with even significant differences present among the transgenic lines.


Figure 4 Evaluation of detached leaf for resistance to S. Sclerotiorum
 
1.3.2 Adult plants assay
The adult plants of 7 transgenic lines and the wild-type control were inoculated using mycelia inoculation method, the lesion expanded up and down the stem from the inoculation point after 4 days. The appearance of rape stem inoculated with S. Sclerotiorum is provided in Figure 5A. The lesion was approximately 13 cm long on the control plant inoculated with S. sclerotiorum for 7 days, while it varied from 0.5 cm to 10.9 cm on the transgenic lines carryingMSI-99m.Thediseaseindex of all the transgenic lines were lower than in the control, of which line M14 was the more resistant with a disease index of 8. 9 (Figure 5 B).


Figure 5 Evaluation of adult plant for resistance to S. Sclerotiorum
 
2 Discussion
Sclerotina rot caused by Sclerotinia sclerotiorum is one of the most severe diseases inrape and would cause huge economic losses (Dong et al., 2008). The introduction of resistant genes into rape to improve its resistance is therefore of considerable importance and has obtained some achievement (Ganapathi et al., 2001; May et al., 1995). Of the successful events, it can be noted to be the application of wheat Oxalate oxidase gene OXO in oilseed rape and its constitutive expression in transgenic rape considerably increased OXO activity and enhanced resistance to S. sclera- tiorum with disease reductions from 88.4% to 90.2% (Dong et al., 2008). In addition, it was also reported that over-expression of a mitogen-activated protein kinase (BnMPK4) led to increased tolerance to S. sclerotiorum infection in transgenic rape canola (Wang et al., 2009). The genes used in the studies above belong to specific genes in functions which generally lack stability and easily lose their resistance when new pathogen racesemerge due to mutation. Hence genes with multi-resistance are preferred in potato genetic breeding.
MSI-99 gene is a synthesized magainin II analogue with high inhibitory effects to a wide spectrum of microbial organisms, including bacteria, fungi and protozoa (Zasloff, 1987). To this day, MSI-99 has been transferred into tomato (Alan et al., 2004), tobacco (Chakrabarti et al., 2003; DeGray et al., 2001), banana (Atkinson et al., 2003), potato (Ganapathi et al., 2007; Hong et al., 2012) and grapevine (Vidal et al., 2006). However it has not been reported in rape yet. In this study, the MSI-99m gene was successfully transferred into the rape cultivar Zhongyou 821 by Agroba- cterium-mediated transformation and its expression made transgenic rape plants more resistant to S. sclerotiorum.
In this study, detached leavestest and adult plant test were respectively carried out for the evaluation of the resistance of transgenic rape lines. Transgenic lines except line M10 was more resistant to S. sclerotiorum than wild-type control, with the level of resistance varying among the transgenic lines, and the results were consistent in two assays. Notable variation among the transgenic lines was observed and could be attributed to the random inserting of the gene in Agrobacterium-mediated genetic transformation (Alvarez et al., 2000; Butaye et al., 2004; Demeke et al., 1999; Srivastava et al., 1996).
Rape suffers serious threats from pathogens, such as Peronospora parasiticaandAlbugo candida.There is an urgent need for multi-resistant varieties in rape production. Previous studies have demonstrated that MSI-99 possesses a wide spectrum of resistance including Sclerotinia sclerotiorum, Alternaria alternate, Botrytis cinerea, Pseudomonas syringae pv tabaci, Aspergillus flavus, Fusarium moniliforme, Verticillium dahliae, Colletotrichum destructivum etc. Further analysis on the resistance of the transgenic rape lines against other pathogens would provide more valuable evidence for the application of MSI-99m gene in the improvement of rape diseases resistance.
3 Materials and methods
3.1 Plant and fungal pathogen
The rape (Brassica napus L.) cultivar Zhongyou 821 was used as recipient in this transformation experiment. Seeds of Zhongyou 821 were soaked in 75% ethanol for 30 s, immersed in 0.1% HgCl2 for 1 min, and surface-sterilized for 5 min in a 2% Na-hypochlorite solution. The seeds were subse- quently rinsed three times with sterile distilled water and germinated on hormone-free MS medium (Murashige and Skoog, 1962) at 25℃ under a 16/8 h photoperiod at a light intensity of 44 μmol·m-2·s-1 and 60%~90% relative humidity. The sclerotia of the fungus S. sclerotiorum were cultured to produce mycelial inoculum on potato dextrose agar at 28℃.
3.2 Bacterial strains
Agrobacterium tumefaciens strain GV3101 containing vector pGS-MSI-99m constructed by our laboratory was cultured in LB medium (pH 7.0) supplemented with 100 mg/L kanamycin (Kan) and 50 mg/L rifampicin (Rif) at 28℃. The structure of the vector pGS-MSI-99m was showed in Figure 6.


Figure 6 Structure of recombined pGS-MSI99 vector

3.3 Genetic transformation and plant regeneration
Rape plants were transformed with MSI-99m gene using Agrobacterium-mediated method. A single colony of A. tumefaciens strain GV3101 harboring the vector pGS-MSI-99m was cultured in liquid LB medium with 100 mg/L kanamycin (Kan) and 50 mg/L rifampicin (Rif) at 28°C overnight. The bacteria was then harvested by centrifugation at 5000×g for 10 min and resuspendedto an optical density of OD600 = 0.2 in MS medium supplemented 200 μM acetosyringone. Cotyledons from 6-day-old seedlings were excised with 2 mm petiole at the base and hypocotyls were cut to 0.5 cm segments. The explants were immersed in the bacterial suspension for 5 min. They were subsequently placed on RM1 (solid MS medium in 500 mg/L MES buffer supplemented with 1.0 mg/L 2,4-D and 200 μM acetosyringone, pH 5.2) for co-culture at 25°C for 2 days in the dark. After co-cultivation, the explants were washed with sterile water containing 300 mg/L cefotaxime (Cef) to inhibit the growth of A. tumefaciens on the explants surface transferred to RM2 (solid MS medium with 3.5 mg/L 6-BA, 0.1 mg/L NAA, 5.0 mg/L AgNO3 and 300 mg/L Cef) for 2 weeks. After that, the explants with callus were transferred to RM3 (solid MS medium with 3.5 mg/L 6-BA, 0.1 mg/L NAA, 5.0 mg/L AgNO3 , 300 mg/L Cef, and 10 mg/L Kan) for shoot induction. Subculture of the explants was done on fresh RM3 medium every 2 weeks. Green shoots (approximately 3 cm in length) were excised from the explants and transferred to RM4 (solid MS medium with 0.2 mg/L NAA, 300 mg/L Cef, and 15 mg/L Kan) for rooting and recovering of complete plants. Except for the RM1 medium, all of the other aforementioned media were adjusted to pH5.8. Cultures were maintained at 25℃ with the photoperiod of 16 h/8 h (light/dark). One month later, surviving green plantlets on medium with Kan were transplanted in pots in a greenhouse for molecular identification and evaluation of their disease resistance.

3.4 PCR analysis
The presence of the MSI-99m gene in transgenic plants was detected by PCR. The fresh leaves of transformed and control plants were used to extract genomic DNA following a modified SDS method(Hu et al., 2003). The transgenic plants were identified with the primer pair (Primer 1: 5'ATTGATGTGATATCTCCACTGACGTAAG and Primer 2: 5'TCTGCAGTTAAGAATTAAGAATTTCCTT). The PCR product was expected to be a 400-bp fragment containing the partial sequence of the pGS vector. PCR amplifications were performed with the following thermal cycling conditions: 94℃ for 4 min, 30 cycles of 94℃ for 1 min, 57℃ for 40 s, 72℃ for 35 s; followed at 72°C for 10 min. The purified product was then clonedinto the pMD-19T vector (TaKaRa) for sequencing (Beijing Genomics Institute, China).
3.5 Quantitative Real-Time PCR Analysis
To detect the expression of the MSI-99m gene in transgenic plants, Total RNA was isolated from the leaves of 4-week-old transgenic and control plants using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions and treated with RNase-free DNase to remove genomic DNA. The cDNA was synthesized using the TaKaRa Reverse Transcription System kit (TaKaRa Biotech, Dalian, China). The rape EF-1α gene was used as an internal control. The amplification was performed with Primer 3: (5'ATGCTTCTTGCTATTGCTTTTCTTGC) and Primer 4: (5'TCTGCAGTTAAGAATTAAGAATTTCCTT) designed according to the MSI-99m sequence. The qRT-PCR was carried out on an Applied Biosystems 7300 Real Time PCR System with a 20 µL reaction volume, containing 1µL 10-fold diluted cDNA, 0.3 µL (10 pm) of each primer , 10 µL SYBR®Premix Ex TaqTM (Perfect Real Time) (TaKaRa Code:DRR041A) and 8.4µl sterile double distilled water. The PCR conditions consisted of denaturation at 95℃ for 4 min, followed by 40 cycles of 95℃ for 20s, 57℃ for 20s and 72℃ for 40s. The specificity of the individual PCR amplification was checked using a heat dissociation curve from 55 to 95℃ following the final cycle of the PCR. The correspondence expression content (2−ΔΔCT) of MSI-99m mRNA was calculated as following: ΔΔCT=(CT.Target− CT. EF-1α)×X−(CT.Target – CT. EF-1α)×T. X stands for different lines and T stands for one time expression of MSI-99m after calibration by EF-1α.Every experiment was repeated three times.
3.6 Evaluation of the disease resistance of transgenic plants
S. Sclerotiorum resistance of the transgenic lines was assessed using detached leaf, young plant and adult plant. Untransformed rapeZhongyou 821 was used as a control.
3.6.1 Detached leaf inoculation test
For the detached leaf inoculation tests, second true leaves from plants of four-true-leaf stage grown in the glasshouse were collected as plant materials(Verma et al., 2012). A pipette tip was used to gently wound the leaf at the inoculation site. 30 μL spore suspension (1×107 spores/mL) was dropped on sterile filter paper discs (5 mm) and pieces of sterilized flower petals were put onto each side of the filter paper discs. Then the filter paper discs were placed onto the main vein position of detached leaves. All leaves were arranged on wet gauze in containers that were collectively covered with transparent polyethylene bags maintaining suitable moisture. The leaves in the containers were incubated at 22℃ in a dark room. The leaf inoculation experiment was performed with three biological replicates and eight leaves per replicate. Four days post-inoculation, disease severity was assessed on a 0~4 scale [0=no lesions; 1=percentage of lesion area on leaf≤10%; 2=11% ≤ percentage of lesion area on leaf≤30%; 3=31% ≤ percentage of lesion area on leaf≤50%; 4=percentage of lesion area on leaf ≥51%]. The disease index was calculated as following described (here k=4).
3.6.2 Adult plant inoculation test
Stems of rape in blooming adult plants were inoculated with S. sclerotiorum. Mycelia of S. sclera- tiorum were cultured on potato dextrose agar, and some agar discs were excised from the edges of growing colonies. A hole at the location of 35 cm above ground on each plant stem made by a punch and was filled with an agar disk. The tresis vulnuses were wrapped with plastic laboratory film to prevent agar plugs from desiccating or falling off. Stem inoculation was performed with three biological replicates with at least six plants per replicate. After 7 days of infection, disease severity was assessed on a 0~4 scale and disease index was calculated as following described (here k=4). The standard of disease index was: 0=no symptoms; 1=the lesion length on the stem was below 3.33 cm; 2=the lesion length on the stem was between 3.33 and 6.66 cm; 3=the lesion length on the stem was between 6.66 and 9.99 cm; 4=the lesion length on the stem was over 9.99 cm.
3.6.3 Statistical analysis
We used disease index to evaluate the ability of resistance to S. Sclerotiorum. Disease index was calculated by 100∑(I n1)/(N k), where I is a disease severity score on the 0–4 scale, n1 is the number of plants with each score, N is total number of plants assessed and k is the highest score. Statistical analysis for these experiments was done using the SAS programmer (SAS Institute, Raleigh, N.C.).
Acknowledgments
This study was supported financially by grants from the Jiangsu Agricultural Science and Technology Innovation Fund (NO. cx (11)1020), National Natural Science Foundation of China (NO. 11171155) and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions: Modern horticultural science (PAPD). We specially thank Prof. Xiu-Qing Li and Miss Chidie Yang for his assistance in writing the manuscript.
References
Aboudy Y., Mendelson E., Shalit I., Bessalle R., and Fridkin M., 1994, Activity of two synthetic amphiphilic peptides and magainin -2 against herpes simplex virus types 1 and 2, International journal of peptide and protein research, 43 (6): 573-582
http://dx.doi.org/10.1111/j.1399-3011.1994.tb00559.x
Alan A., Blowers A., and Earle E., 2004, Expression of a magainin-type antimicrobial peptide gene (MSI-99) in tomato enhances resistance to bacterial speck disease, Plant cell reports, 22 (6): 388-396
http://dx.doi.org/10.1007/s00299-003-0702-x
Alvarez M., Guelman S., Halford N., Lustig S., Reggiardo M., Ryabushkina N., Schewry P., Stein J., and Vallejos R., 2000, Silencing of HMW glutenins in transgenic wheat expressing extra HMW subunits, TAG Theoretical and Applied Genetics, 100 (2): 319-327
http://dx.doi.org/10.1007/s001220050042
Atkinson H., Dale J., Harding R., Kiggundu A., Kunert K., Muchwezi J., Sagi L., and Viljoen A., 2003, Genetic transformation strategies to address the major constraints to banana and plantain production in Africa, International Plant Genetic Resources Institute:
Broekaert W.F., Cammue B.P., De Bolle M.F., Thevissen K., De Samblanx G.W., Osborn R.W., and Nielson D.K., 1997, Antimicrobial peptides from plants, Critical Reviews in Plant Sciences, 16 (3): 297-323
Butaye K.M., Goderis I.J., Wouters P.F., Pues J.M.T., Delauré S.L., Broekaert W.F., Depicker A., Cammue B., and De Bolle M.F., 2004, Stable high‐level transgene expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions, The plant journal, 39 (3): 440-449
http://dx.doi.org/10.1111/j.1365-313X.2004.02144.x
Chakrabarti A., Ganapathi T.R., Mukherjee P.K., and Bapat V.A., 2003, MSI-99, a magainin analogue, imparts enhanced disease resistance in transgenic tobacco and banana, Planta, 216 (4): 587-596
Conlon J.M., and Kim J.B., 2000, A Protease Inhibitor of the Kunitz Family from Skin Secretions of the Tomato Frog, Dyscophus guineti (Microhylidae), Biochemical and Biophysical Research Communi- cations, 279 (3): 961-964
http://dx.doi.org/10.1006/bbrc.2000.4052
DeGray G., Rajasekaran K., Smith F., Sanford J., and Daniell H., 2001, Expression of an antimicrobial peptide via the chloroplast genome to control phytopathogenic bacteria and fungi, Plant physiology, 127 (3): 852-862
http://dx.doi.org/10.1104/pp.010233
Demeke T., Hucl P., Båga M., Caswell K., Leung N., and Chibbar R., 1999, Transgene inheritance and silencing in hexaploid spring wheat, TAG Theoretical and Applied Genetics, 99 (6): 947-953
http://dx.doi.org/10.1007/s001220051401
Dong X., Ji R., Guo X., Foster S.J., Chen H., Dong C., Liu Y., Hu Q., and Liu S., 2008, Expressing a gene encoding wheat oxalate oxidase enhances resistance to Sclerotinia sclerotiorum in oilseed rape (Brassica napus), Planta, 228 (2): 331-340
http://dx.doi.org/10.1007/s00425-008-0740-2
Everett N.P., 1994, Design of antifungal peptides for agricultural applications, in, ACS Symposium Series, ACS Publications. pp. 278- 278
Ganapathi T., Ghosh S., Laxmi N., and Bapat V., 2007, Expression of an antimicrobial peptide (MSI-99) confers enhanced resistance to Aspergillus niger in transgenic potato, Indian Journal of Biotechnology, 6 (1): 63
Ganapathi T., Higgs N., Balint-Kurti P., Arntzen C., May G., and Van Eck J., 2001, Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB), Plant cell reports, 20 (2): 157-162
http://dx.doi.org/10.1007/s002990000287
Guo X., and Stotz H.U., 2007, Defense against Sclerotinia sclerotiorum in Arabidopsis is dependent on jasmonic acid, salicylic acid, and ethylene signaling, Molecular Plant-Microbe Interactions, 20 (11): 1384-1395
http://dx.doi.org/10.1094/MPMI-20-11-1384
Hong Y.-b., Liu S.-p., Zhu Y.-p., Xie C., Jue D.-w., Chen M., Kaleri H.A., and Yang Q., 2012, Expression of the MSI-99m gene in transgenic potato plants confers resistance to phytophthora infestans and ralstonia solanacearum, Plant Molecular Biology Reporter: 1-7
Hu J., Nakatani M., Lalusin A.G., Kuranouchi T., and Fujimura T., 2003, Genetic analysis of sweetpotato and wild relatives using inter-simple sequence repeats (ISSRs), Breeding science, 53 (4): 297-304
http://dx.doi.org/10.1270/jsbbs.53.297
Maloy W.L., and Kari U.P., 2004, Structure–activity studies on magainins and other host defense peptides, Biopolymers, 37 (2): 105-122 http://dx. doi.org/10.1002/bip.360370206
May G.D., Afza R., Mason H.S., Wiecko A., Novak F.J., and Arntzen C.J., 1995, Generation of transgenic banana (Musa acuminata) plants via Agrobacterium-mediated transformation, Nature biotechnology, 13 (5): 486-492
http://dx.doi.org/10.1038/nbt0595-486
Momoh E., Zhou W., and Kristiansson B., 2002, Variation in the develo- pment of secondary dormancy in oilseed rape genotypes under conditions of stress, Weed Research, 42 (6): 446-455
http://dx.doi.org/10.1046/j.1365-3180.2002.00308.x
Murashige T., and Skoog F., 1962, A revised medium for rapid growth and bio assays with tobacco tissue cultures, Physiologia plantarum, 15 (3): 473-497
http://dx.doi.org/10.1111/j.1399-3054.1962.tb08052.x
O’Callaghan M., Gerard E.M., Bell N.L., Waipara N.W., Aalders L.T., Baird D.B., and Conner A.J., 2008, Microbial and nematode communities associated with potatoes genetically modified to express the antimicrobial peptide magainin and unmodified potato cultivars, Soil Biology and Biochemistry, 40 (6): 1446-1459
http://dx.doi.org/10.1016/j.soilbio.2007.12.028
Rao A.G., 1995, Antimicrobial peptides, Mol. Plant-Microbe Interact, 8 (6): 13
Srivastava V., Vasil V., and Vasil I., 1996, Molecular characterization of the fate of transgenes in transformed wheat (Triticum aestivum L.), TAG Theoretical and Applied Genetics, 92 (8): 1031-1037
http://dx.doi.org/10.1007/BF00224045  
Verma S.S., Yajima W.R., Rahman M.H., Shah S., Liu J.-J., Ekramoddoullah A.K., and Kav N.N., 2012, A cysteine-rich antimicrobial peptide from Pinus monticola (PmAMP1) confers resistance to multiple fungal pathogens in canola (Brassica napus), Plant molecular biology, 79 (1-2): 61-74
http://dx.doi.org/10.1007/s11103-012-9895-0
Vidal J.R., Kikkert J.R., Malnoy M.A., Wallace P.G., Barnard J., and Reisch B.I., 2006, Evaluation of transgenic ‘Chardonnay’(Vitis vinifera) containing magainin genes for resistance to crown gall and powdery mildew, Transgenic research, 15 (1): 69-82
http://dx.doi.org/10.1007/s11248-005-4423-5
Wang Z., Mao H., Dong C., Ji R., Cai L., Fu H., and Liu S., 2009, Overexpression of Brassica napus MPK4 enhances resistance to sclerotinia sclerotiorum in oilseed rape, Molecular Plant-Microbe Interactions, 22 (3): 235-244
http://dx.doi.org/10.1094/MPMI-22-3-0235
Zasloff M., 1987, Magainins, a class of antimicrobial peptides from Xenopus skin: isolation, characterization of two active forms, and partial cDNA sequence of a precursor, Proceedings of the National Academy of Sciences, 84 (15): 5449-5453
http://dx.doi.org/10.1073/pnas.84.15.5449


Zasloff M., 1988, Magainins, a class of antimicrobial peptides from Xenopus skin: Isolation, characterization of two active forms, and partial cDNA sequence of a precursor, Journal of Ethnopharmacology, 23 (2–3): 360
http://dx.doi.org/10.1016/0378-8741(88)90095-5

Molecular Plant Breeding
• Volume 4
View Options
. PDF(892KB)
. FPDF
. HTML
. Online fPDF
Associated material
. Readers' comments
Other articles by authors
. Xuelian Sang
. Dengwei Jue
. Liu Yang
. Xiao Bai
. Min Chen
. Qing Yang
Related articles
. Brassica napus
. MSI-99m
. Transformation
. Sclerotinia sclerotiorum
. Disease resistance
Tools
. Email to a friend
. Post a comment

Terms and Conditions | Returns and Refund Policy | Privacy Statement | Information for Advertisers | Contact GenBreed Publisher

Copyright © 2019 Sophia Publishing Group Inc.