Background

High molecular weight (HMW) glutenin is one of the important storage proteins of common wheat, whose subunit types are coded by Glu-A1, Glu-B1 and Glu-D1 genes on chromosomes 1A, 1B and 1D of common wheat, respectively. Among them, Glu-D1 locus is known to have stronger effect on better bread-baking quality than other loci (Gupta and Macritchie, 1994; Pena et al., 1995; Wang et al., 1995; Yang et al., 2009); In common wheat, bread-baking quality of bread wheat expressing HMW-GS Dx5 is often better than that with HGW-GS Dx2 (Branlard and Dardevet, 1985; Tronsmo et al., 2003; Yang et al., 2009; Jin et al., 2013).

Aegilops tauschii (Ae. tauschii, 2n=2x=14, DD) is the ancestral donor of the D genome of common wheat. Syntheic hexaploid wheat (SHW) is derived from the cross of Triticum turgidum (2n=4x=28, AABB) with Ae. tauschii (Mujeeb-Kazi et al., 1996). Inheriting vast genetic diversities from T. turgidum and Ae. tauschii, SHW performed better in disease resistance and stress tolerance, and was often used as a bridge-tool for wheat improvement (Del Blanco et al., 2001; Yang et al., 2009; Li et al., 2014). With deep application of SHW in wheat breeding, more and more HMW-GS of Ae. tauschii have been transferred to common wheat (Yang et al., 1998; Yan, 2001; Wang et al., 2006; Jiang et al., 2009; Chen, 2012). Analysis in reversed phase of high-performance liquid chromatography (RP-HPLC) by Pflüger et al. (2001) showed that HMW-GS D^tx5 of Ae. tauschii and Dx5 of common wheat were different in surface hydrophobicity which was caused by the extra cysteine residues of Dx5 subunit that was absent in D^tx5 subunit, and it resulted in significant difference in end-use quality that was also observed by our resent research. SDS-PAGE was usually used to distinguish different HMW-GS types in common wheat. However, this traditional method has weakened efficiency on distinguishing the two types of subunit 5 on HGW-GS D1 locus and whether they were from common wheat or Ae. tauschii.

According to sequence comparison between HGW-GS D1 loci of Ae. tauschii and common wheats from NCBI and Lu et al. (2004), several SNP sites were observed among Dx5 subunit sequences from different germplasm sources, and the allele-specific polymerase chain reaction (AS-PCR) markers were designed according to these SNPs, to distinguish two types of Dx5 with different genetic sources in this study. Comparing with traditional SDS-PAGE used in HMW-GS identification, firstly, AS-PCR technology is easier to cooperate with a large quantity of SNPs in the whole genome, which shows great application prospect, such as derived KASP technology (Semagn et al., 2014); and secondly, AS-PCR is more cost-effective and time-efficient when used in diagnostic screening. Thus, AS-PCR technology has been widely applied in marker-assisted selection (MAS) for HMW-GS (Zhao, 2004; Zhou et al., 2004; Lu et al., 2005; Sun et al., 2006; Liu et al., 2010; Sun et al., 2013; Wan et al., 2014). The AS-PCR markers developed in this study overcame the disadvantages that traditional SDS-PAGE failed to distinguish HMW-GS D^tx5 of Ae. tauschii and Dx5 of common wheat.

1 Results and Analysis

1.1 SDS-PAGE analysis

HMW-GS D1 locus types of four commercial wheat cultivars, Chinese Spring, Yecora, SHW Syn768, Chuanmai 42, and 17 F₂ lines derived from the hybridization between Chuanmai 42 and Syn768 (SHW) were analyzed in traditional SDS-PAGE. The subunits of Yecora, Syn768 and Chuanmai 42 on HMW-GS D1 locus had the same electrophoretic mobility, and they were shown as Dx5 subunit type (Figure 1). Among them, Yecora was one famous bread wheat with Dx5 subunit of common wheat (Caballero et al., 2001); Syn768 was a line of SHW with its D^tx5 from Ae. tauschii, Chuanmai 42 was SHW-derived cultivar and its Dx5 had two possible sources from the common wheat or Ae. tauschii, according to the pedigree of Chuanmai 42. The HMW-GS protein bands of the Chuanmai 42 x Syn768 F₂ population had the same mobility in SDS-PAGE, identifying as Dx5, but their parental source couldn’t be identified in SDS-PAGE.

Considering disadvantage of traditional SDS-PAGE on distinguishing D^tx5 and Dx5, new methodology needed to be applicated with the aim to classify their wheat flour quality category precisely when introgressing elite Ae. tauschii resources into common wheat in breeding. According to the identified SNPs existed in D^tx5 and Dx5 sequences, a series of AS-PCR primers were designed to identify two types of subunit 5 from different genetic sources.

1.2 AS-PCR analysis of D^tx5 and Dx5

AS-PCR primer P7 and P8 were designed from the SNPs between non-coding region and N-terminal region of HMW-GS Dx5 and D^tx5 genes, respectively. The primers were developed on the sequence of common wheat Dx5 gene, and the combination of primers P7+P8 could amplify a specific fragment of about 489 bp from the common wheats carrying Dx5 gene. The accessions carrying the homozygous genotype of the common wheat Dx2 or Ae. tauschii D^tx5 genes couldn’t show any P7+P8 amplified DNA fragments in the gel. The PCR system and amplification condition of the primer combination P7+P8 were optimized through the method descripted by Wan et al. (2014). The length of amplified PCR fragment was the same as expected fragment length (Figure 2). Chinese Spring and Syn768 had no PCR amplified bands, which indicated the absence of common wheat Dx5 (Figure 2). Yecora and Chuanmai 42 had amplified 489 bp bands, which carried common wheat Dx5 (Figure 2). D^tx5 homozygous locus, such as lane No. 10, 11, 14 and 24 were detected without any amplified fragments in 17 F₂ individuals from the cross Chuanmai 42 × Syn768 (Figure 2). Other F₂ individuals with specific fragments of 489 bp carried homozygous or heterozygous genotypes of Dx5/Dx5 or Dx5/D^tx5 due to the dominance of AS-PCR marker.

The forward primer P6 was designed based on G/A SNP at -27 bp site between coding regions of D^tx5 and Dx5, genes. The reverse primer P2 was a universal primer for the series of AS-PCR primers, which located in the repetitive domain of Dx5 subunit and had two primer binding sites. The expected fragment lengths between P6 and P2 primer binding sites are 430 bp and 540 bp. After optimizing the amplification procedure and PCR system of AS-PCR primer combination P6+P2, two fragments of about 430 bp and 540 bp lengths were amplified simultaneously in this study (Figure 3), as expected. The results of gel electrophoresis for PCR products amplified by P6+P2 primers were entirely consistent with P7+P8 primers analysis. Thus, these AS-PCR markers designed on the SNPs located at different domains of subunit 5 of HWW-D1 gene in this study, could be stably applied to distinguish D^tx5 from Dx5 in common wheat.

The amplification conditions of P6+P2 primers were much stringent than those of P7+P8 primers, because only one SNP was involved in the design of P6+P2 primer combination at -27 bp site of P6 primer region (Figure 4). However, for P7+P8 primers combination, the both primers covered two SNPs at -222 bp and 170 bp sites, respectively. An introducing of SNPs to both forward and reverse primers could be benefit to MAS for Dx5 or D^tx5 in large scale PCR analysis.

1.3 Homology analysis of amino acid sequence of polypeptides D^tx5, Dx5 and Dx2

HMW-GS D^tx5 types of Ae. tauschii have been introgressed into the common wheat more frequently with application of SHW in common wheat breeding. It is inconclusive that Dx5 subunits from Ae. tauschii could improve bread quality with few reports at present (Lafiandra et al., 1993; Ren et al., 2008). In this study, Dx2 subunit significantly related to undesirable bread-baking quality and Dx5 subunit related to good bread-baking quality were used as controls to speculate the bread-baking quality of D^tx5, by homology analysis and comparison of their protein sequence. The peptide of 21 amino acid residues at the N-terminus of secretory proteins is signal peptide in the front of the protein sequence (Figure 5A), which is for protein targeted to the endoplasmic reticulum and cleaved after protein maturity. As a recognized subunit of high quality, common wheat Dx5 subunit with good bread-baking quality has 4 cysteine residues on the N-terminal of protein, while Dx2 and D^tx5 subunits only have 3 cysteine residues on the N-terminal. Comparing to D^tx5 and Dx2, an extra cysteine residue of Dx5 subunit existed on the N-terminal near to repetitive domain of protein sequence (Figure 5A). The homology between D^tx5 of Ae. tauschii and Dx2 of common wheat was 99%, which was higher than homology between either of them and Dx5 (Figure 5B), indicating that D^tx5 was more similar with Dx2 in protein sequence. For D^tx5, its lack of the extra cysteine residue and more similarity to Dx2 than Dx5 suggested that the end-use quality of D^tx5 was much closer to Dx2 and negatively correlated with bread-baking quality as Dx2.

2 Discussion

2.1 Comparison analysis of D^tx5, Dx5 and Dx2

The +170 bp G/C SNP at 3’-teminal of the primer P8 was shown as the difference between cysteine and serine on protein sequence where this cysteine residue was at the N-terminal near to the repetitive domain of Dx5 subunit. Cysteine residue is usually thought to be able to increase the number of interchain disulfide bonds that can enhance the gluten elasticity and improve the bread-baking quality. This cysteine residue was included in Dx5 of common wheat, but not included in either D^tx5 of Ae. tauschii or Dx2 of common wheat. Besides, through RP-HPLC analysis, Pflüger et al. (2001) found that the surfaces of HMW-GS D^tx5 and Dx5 were differently hydrophobous, which was caused by the number of cysteine residues of subunit 5. Protein sequence homology was also analyzed on D^tx5, Dx5 and Dx2 in this study, and the result showed that homology between D^tx5 and Dx2 was higher than that between D^tx5 and Dx5. According to the cysteine residue number and the homology among Dx2, Dx5 and D^tx5 subunits, the study speculated that the bread-baking quality of D^tx5 was similar with that of Dx2 (Lafiandra et al., 1993). However, further research was needed to check the speculation.

2.2 AS-PCR identification of D^tx5 and Dx5

The donor of the common wheat D genome was originated narrowly from one sub-species of Ae. tauschii spp. tauschii (Wang et al., 2013), while Ae. tauschii groups in nature contained vast genetic variation. SHW was derived from T. turgidum and Ae. tauschii existing in nature, which extended the genetic background of common hexaploid wheat (Wang et al., 2010). It enriched the resources of gene pool for disease resistance and stress tolerance in common wheat, and was a great ‘bridge tool’ of applying the wild germplasm resources on wheat breeding. Hereafter, with more SHWs being applied in wheat breeding, common breed wheat appears to have more HMW-GS types from Ae. tauschii. However, Ae. tauschii D^tx5 lacked the extra cysteine residue of common wheat Dx5, which resulted in different end-use quality, and its breeding identification with SDS-PAGE is not favorable for the same electrophoretic mobility of two genetic sources of subunit 5 in gel.

AS-PCR was much faster and more accurate than SDS-PAGE in HMW-GS identification. However, based on single nucleotide substitution, the designed AS-PCR markers needed a stringent reaction condition to avoid false positive amplification, comparing to the co-dominant SSR marker (Luo et al., 2010). Through the comparison of several DNA sequences of D^tx5 and Dx5, a total of 3 SNPs was found and verified in this study. Among them, the SNP at the primer P6 region was newly discovered and successfully applied to identify two Dx5 subunits from different genetic source. In general, the more SNPs sites introduced to one AS-PCR primer combination, the looser their PCR reaction condition needed, which was more advantageous for diagnostic screening in large scales.

In conclusion, the three SNPs detected in this study were confirmed to be successfully applied in molecular identification for two different types of subunit 5 in Glu-D1 locus. One of the three SNPs led to the difference between cysteine and serine residues in protein sequences of Dx5 and D^tx5, respectively. The end-use quality of Ae. tauschii D^tx5 subunit was more similar with the common wheat Dx2 subunit, for their absence of an extra cysteine residue in both and more protein sequence similarity between them.

3 Materials and Methods

3.1 Experimental materials

Experimental materials included Chinese Spring (HMW-GS: Null, 7+8, 2+12), Yecora (1, 17+18, 5+10) (Caballero et al., 2001), SHW Syn768 (provided by Prof. Mujeeb-Kazi, CIMMYT. Mexico), Chuanmai 42 (selected from Syn768 (SHW)/SW 3243/Chuan 6415 by Dr. Yang Wuyun, Sichuan Academy of Agricultural Science, Chengdu, China), and F₂ population from the cross of Chuanmai 42 x Syn768.

3.2 SDS-PAGE analysis

One single well-filled seed was selected for each sample, and its endosperm was crushed using a sample plier. The embryo from the same seed was preserved for germination and further DNA extracting from seedling leaves for AS-PCR detection. Crushed powder of endosperm was collected in a 1.5 mL centrifuge tube. Gliadins were extracted with 50% (v/v) propan-2-ol at the rate of 1:10 (sample weight, mg; extraction solution, μL) in 60-65°C bathing water for 20-30 min. After incubation at room temperature for 2 h, the treated samples were centrifuged at 10,000 rpm for 10 min and the reserved precipitation was almost constituted by glutenin. The procedure was repeated twice to remove all the gliadins as possible. Glutenin as above-mentioned precipitation was dissolved in HMW-GS extraction buffer (10 mL Sample Buffer+200 mg DDT+10 mL H₂O; Sample buffer: 4 g SDS, 20 mL glycerinum, 25 mL 0.5 M Tris, 25 mg bromophenol blue, and 11.5 mL H₂O, pH=6.8) at the rate of 1:7 in 60-65°C bathing water for 2 h with agitation every 20 min. After the centrifugation at 10,000 rpm for 10 min, the supernatant was aspirated and kept in 4°C (Yan et al., 2002).

The soluble supernatant of glutenin was fractionated by electrophoresis in vertical SDS-PAGE slabs in a discontinuous Tris-HCl-SDS buffer system with 7% polyacrylamide for stacking gel (pH=6.8; C=3%) and 13% polyacrylamide for separating gel (pH=8.8, C=3%), then the samples were electrophoresed at 10 mA constant voltage, current per gel for 20 h at room temperature. After electrophoresis, the separating gel was dyed in 10% trichloroacetic acid/0.025% Coomassie Brilliant Blue R-250 for 12 h and de-stained with 10% ethanol solution until the band of HMW-GS was clearly visible.

3.3 Comparison of HMW-GS D1 locus sequence of Ae. tauschii and common wheat genome

NCBI reference sequence of HMW-GS D^tx5 (AY804129), Dx5 (DQ211818), Dx2 (X03346) and sequencing results of HMW-GS D1 locus of Ae. tauschii and common wheat from Lu (2004) were used for DNA sequence comparison and SNP discovery in this study. Protein sequence comparison and homologous analysis were operated in DNAMan v6.0 software (Lynnon Biosoft, USA).

The primers P6 and P8 covered SNP located at N-terminal domain of Dx5 coding region and 3’-terminal nucleotides of both primers were designed as the locations of SNP sites. The +170 bp G/C SNP on P8 region affected the protein sequence of Dx5 subunits on amino acid substitution from cysteine to serine (Figure 6). The -27 bp G/A SNP on P6 region did not affect the protein sequence of Dx5 (Figure 6). SNP on P7 region was on the non-coding region of Dx5. P2, as a universal primer, was in the repetitive domain and has two primer binding sites (Figure 4).

3.4 AS-PCR analysis

The genomic DNA was extracted by the method of CTAB extraction (Murray and Thompson, 1980) from the fresh seedling leaf that was germinated from individual embryo reserved from the experiment of HMW-GS protein extraction.

The sequences of the primers were (5’-3’): P2: TGGTTGTTGCAATTGTCCTG, P6: GCCAGCAGGTCATGGACCAA, P7: CGTCCCTATAAAAGCCTAGCA, and P8: AGTATGAAACCTGCTGCGGAG. The DNA fragment amplified by primer combination P6+P2 were 430 bp and 540 bp, and the primers combination P7+P8 amplified a 489 bp fragment, as expected. PCR system and the amplification condition were as described in Wan et al. (2014), the optimal annealing temperature of primers combination P6+P2 was 64°C in AS-PCR analysis for common wheat Dx5 subunit, and P7+P8 was 63°C. The amplified products were separated by electrophoresis on 1.5%-2.0% agarose gels with 1.0% TAE buffer, and the bands were detected on Gel imaging system (Bio-RAD, California, USA) after staining with ethidium bromide (EB).

Authors’ contributions

QJP performed the statistical analysis and wrote the paper; LJ, ZZF, ZJM, LSZ, PZS and YWY participated in molecular experiment; WHS was the designer and person in charge. All the authors read and approved the final manuscript.

Acknowledgments

The study is co-supported by the National Key Research and Development Program of China (2016YFD0100102), National Natural Science Foundation of China (31401383; 31760425) and Sichuan Science and Technology Program (2015JSCX014; 2017JY0077).

References

Branlard G., and Dardevet M., 1985, Diversity of grain protein and bread wheat quality, II. Correlation between high-molecular weight subunits of glutenin and flour quality characteristics, J. Cereal Sci., 3(4): 345-354

https://doi.org/10.1016/S0733-5210(85)80007-2

Caballero L., Martin L.M., and Alvarez J.B., 2001, Allelic variation of the HMW glutenin subunits in Spanish accessions of spelt wheat (Triticum aestivum ssp. spelta L. em. Thell.), Theor. Appl. Genet., 103: 124-128

https://doi.org/10.1007/s001220100565

Chen W.J., 2012, Molecular identification and breeding utilization of high molecular weight glutenin genes in Aegilops tauschii, Dissertation of Sichuan Agricultural University, Supervisor: Liu D.C. and Zhang L.Q., pp.39-53 (in Chinese with English abstract)

Del Blanco I.A., Rajaram S., and Kronstad W.E., 2001, Agronomic potential of synthetic hexaploid wheat derived populations, Crop Sci., 41(3): 670-676

https://doi.org/10.2135/cropsci2001.413670x

Gupta R.B., and Macritchie F., 1994, Allelic variation at glutenin subunit and gliadin loci Glu-1, Glu-3 and Gli-1 of common wheats, II, Biochemical basis of the allelic effects on dough properties, J. Cereal Sci., 19(1): 19-29

https://doi.org/10.1006/jcrs.1994.1004

Jiang Y., Yuan H.J., Wang Y., and Xuan P., 2009, Subunits composition and expression of high molecular weight glutenin in Triticum durum-Aegilops tauschii synthetic hexaploid wheat, Xinan Nongye Xuebao (Southwest China Journal of Agricultural Sciences), 22(2): 268-290 (in Chinese with English abstract)

Jin H., He Z.H., Li G.Y., Mu P.Y., Fan Z.R., Xia X.C., and Zhang Y., 2013, Effects of high molecular weight glutenin subunits on wheat quality by Aroona and its near-isogenic lines, Zhongguo Nongye Kexue (Scientia Agricultura Sinica), 46(6): 1095-1103 (in Chinese with English abstract)

Lafiandra D., D’Ovidio R., Porceddu E., Margiotta B., and Colaprico G., 1993, New data supporting high M_r glutenin subunit 5 as determinant of quality differences among the pairs 5 + 10 vs. 2 + 12, J. Cereal Sci., 18: 197-205

https://doi.org/10.1006/jcrs.1993.1046

Li J., Wan H.S., and Yang W.Y., 2014, Synthetic hexaploid wheat enhances variation and adaptive evolution of bread wheat in breeding processes, J Syst. Evol., 52:735-742

https://doi.org/10.1111/jse.12110

Liu S.B., Liang R.Q., You M.S., Li B.Y., and Liu G.T., 2010, Analysis on HMW-GS genes in Dasypyum villosum by SDS-PAGE and allelic specific (AS)-PCR markers, Zhongguo Nongxue Tongbao (Chinese Agricultural Science Bulletin), 26(15): 38-43 (in Chinese with English abstract)

Lu C.M., 2004, Sequence analysis of high molecular weight glutenin subunits in Aegilops tauschii and its in vitro mutation, Dissertation of Fudan University, Supervisor: Lu B.R., pp.69-84 (in Chinese with English abstract)

Lu C.M., Yang W.Y., Zhang W.J., and Lu B.R., 2005, Identification of SNPs and development of allelic specific PCR markers for high molecular weight glutenin subunit D^tx1.5 from Aegilops tauschii through sequence characterization, J. Cereal Sci., 41: 13-18

https://doi.org/10.1016/j.jcs.2004.05.006

Luo R., Wu W.L., Zhang Y., and Li Y.H., 2010, SSR marker and its application to crop genetics and breeding, Jiyinzuxue Yu Yingyong Shengwuxue (Genomics and Applied Biology), 29(1): 137-143 (in Chinese with English abstract)

Mujeeb-Kazi A., Rosas V., and Roldan S., 1996, Conservation of the genetic variation of Triticum tauschii (Coss.) Schmalh. (Aegilops squarrosa auct. non L.) in synthetic hexaploid wheats (T. turgidum L. s. lat.×T. tauschii; 2n=6x=42, AABBDD) and its potential utilization for wheat improvement, Genet. Res. Crop Evol., 43(2): 129-134

https://doi.org/10.1007/BF00126756

Murray M.G., and Thompson W.F., 1980, Rapid isolation of high molecular weight plant DNA, Nucleic Acids Res., 8(19): 4321-4325

https://doi.org/10.1093/nar/8.19.4321

PMid: 7433111

PMCid: PMC324241

Pena R.J., Zacro-Hernandez J., and Mujeeb-Kazi A., 1995, Glutenin subunits composition and bread-making quality characteristics of synthetic hexaploid wheats derived from Triticum turgidum × Triticum tauschii (coss.) schmal crosses, J. Cereal Sci., 21(1): 15-23

https://doi.org/10.1016/S0733-5210(95)80004-2

Pflüger L.A., D’Ovidio R., Margiotta B., Peña R., Mujeeb-Kazi A., and Lafiandra D., 2001, Characterisation of high- and low-molecular weight glutenin subunits associated to the D genome of Aegilops tauschii in a collection of synthetic hexaploid wheats, Theor. Appl. Genet., 103: 1293-1301

https://doi.org/10.1007/s001220100704

Ren Y., Wang T., Xu Z., Yang Z., and Ren Z., 2008, Molecular characterization of a novel HMW-GS 1 Dx5’ associated with good bread making quality (Triticum aestivum L.) and the study of its unique inheritance, Genet. Resour. Crop Evol., 55: 585–592

https://doi.org/10.1007/s10722-007-9262-1

Semagn K., Babu R., Hearne S., and Olsen M., 2014, Single nucleotide polymorphism genotyping using Competitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement, Mol. Breeding, 33: 1-14

https://doi.org/10.1007/s11032-013-9917-x

Sun X.Y., Wu K., Qian Z.G., Mi Y., Mu Q.H., Guo Y., and Li S.S., 2013, Identification of Ax1/Ax2* and Dx5 subunit of wheat HMW glutenin by duplex AS-PCR, Nongxue Xuebao (Journal of Agriculture), 3(5): 8-11 (in Chinese with English abstract)

Sun X.Y., Wu K., Wei X.Y., Lv J.H., and Li S.S., 2006, Identification of HMW-GS 1Dx5 in wheat by AS-PCR, Mailei Zuowu Xuebao (Journal of Triticeae Crops), 26(1): 71-73 (in Chinese with English abstract)

Tronsmo K.M., Merethe E., Mosleth E.F., and Schofield J.D., 2003, Relation between glutenin rheological properties and hearth loaf characteristics, Cereal Chem., 80(5): 575-586

https://doi.org/10.1094/CCHEM.2003.80.5.575

Wan H.S., Wen W., Li J., and Yang W.Y., 2014, Optimization of AS-PCR identification system for HMW-GS D^tx1.5 of synthetic wheat developed with durum wheat and Aegilops tauschii and its genetic analysis, Fenzi Zhiwu Yuzhong (Molecular Plant Breeding), 12(4): 629-637 (in Chinese with English abstract)

Wang F.T., Chen W.Q., and Xu S.C., 2010, Comparison of synthetic hexaploid wheat with its parent on microsattelite loci of A/B chromosomes, Jiyinzuxue Yu Yingyong Shengwuxue (Genomics and Applied Biology), 29(3): 501-506 (in Chinese with English abstract)

Wang J.R., Luo M.C., Chen Z.X., You F.M., Wei Y.M., Zheng Y.L., and Dvorak J., 2013, Aegilops tauschii single nucleotide polymorphisms shed light on the origins of wheat D- genome genetic diversity and pinpoint the geographic origin of hexaploid wheat, New Phytol., 198(3): 925-937

https://doi.org/10.1111/nph.12164
PMid: 23374069

Wang L.M., Lin Z.S., Zhang Z.Y., Chen Y.F., and Xin Z.Y., 2006, Composition analysis of high molecular weight glutenin subunits HMW GS and discovery of a novel subunit in synthetic wheats, hexaploid wheat, Xinan Nongye Xuebao (Southwest China Journal of Agricultural Sciences), 19(1): 1-4 (in Chinese with English abstract)

Wang R., Ning K., and Peňa R.J., 1995, The correlation between high-molecular-weight subunit compositions of some high-quality bread wheat and their hybrid progenies and bread making quality, Xibei Nongye Xuebao (Acta Agriculturea Boreali-Occidentalia Sinica), 4(4): 25-30 (in Chinese with English abstract)

Yan Z.H., 2001, Molecular cloning of high-molecular-weight glutenin subunit genes from Aegilops species, Dissertation of Sichuan Agricultural University, supervisor: Zheng Y.L., and Wang D.W., pp. 20-27 (in Chinese with English abstract)

Yan Z.H., Wan Y.F., Liu K.F., Zheng Y.L., and Wang D.W., 2002, Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits. Chin. Sci. Bull., 47(3): 220-225

https://doi.org/10.1360/02tb9053

Yang W.Y., Hu X.R., and Yu Y., 1998, A survey on high molecular weight subunits in synthetic hexaploid wheat, Xinan Nongye Xuebao (Southwest China Journal of Agricultural Sciences), 11(B&C): 163-166 (in Chinese with English abstract)

Yang W.Y., Liu D.C., Li J., Zhang L.Q., Wei H.T., Hu X.R., Zheng Y.L., He Z.H., and Zou Y.C., 2009, Synthetic hexaploid wheat and its utilization for wheat genetic improvement in China, J. Genet. Genomics, 36(9): 539-546

https://doi.org/10.1016/S1673-8527(08)60145-9

Yang Y.S., Pang B.S., Wang L.F., Zhang X.Y., and Yu Y.J., 2009, Complementary effect of high molecular weight glutenin subunits on bread-making quality in common wheat, Zuowu Xubao (Acta Agronomica Sinica), 35(8): 1379-1385 (in Chinese with English abstract)

Zhao H., 2004, The AS-PCR markers of HMW-GS 1Bx14 and 1Dx5, Thesis for M.S., Shandong Agricultural University, Supervisor: Wang X.Z., pp.6-44 (in Chinese with English abstract)

Zhou L., Wu Y., and Li Z.L., 2004, High molecular weight glutenin subunits in Chuanyu wheat, Yingyong Yu Huanjing Shengwu Xuebao (Chinese Journal of Applied & Environmental Biology), 10(2): 150-153 (in Chinese with English abstract)